Transcript Name :
Phyra_g3
Orientation:
(-)
Number of Exons:
7
Description :
hypothetical protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-368
NN-scoreoddsWeighted Score
0.8211.8450.004
PositionContextScore
365RRQRRPR|AV0.633
TypeScore
nuclear34.8
GO
*** None ***
*** None ***
*** None ***
Sequence
        2924 bases(100 bases per row)
TGGCGGAAGCGCTGCCCGGGCAGAAGCGCAAGTGTACCGGTCCTGTAGGCGCCAGCAAGCGCCGCCGCGCGGGATCTGGTGTCGATACAGCACCGGCGGA
GTCCGCCAGCAGTCTCGGAGGTGTTGCAGTGTTCAAGGGCGCGTGGGCCGCGCTGAAGAAAGCAGGATGGACGTCCAAGAAACCGTCCAGCAAGGGTCTT
GACTCGCGTTACAAGTACATTCGGCCTGGGGTGTAGAGGGTGCTGATTTCCTTCTCGGCGAGCTGGCCGTGCTGAGGTATGTCGAGGAGGTGCGCAACCG
TGACGCCGCAGCAACTGCAGCTAGGCAAGACGTTATGTCTGTGCATGCAGCGGTATGACAAGTGGCTAGGTAGCTGTATGGCTAACGTTGCACTTGTTTG
TGGTGTAGGCGTTGGAGCTCAACGTGGAGAAGACAGTGGCGACGTCGCTGGCAGAGCTGCTGGACAGGCAGTCACTGCCGAACGTCGCCGGCAAGGATCT
AGGCATGGCGACGCCGATCAGGAAGCCTCAAGCGCTGCAGGTGCGGTTGCGTCTTGGGAAGTTGGGCTACAACAACGAGTGGCGCGACTAACGTTGTGTT
TGTTGGTGGTTTGACTAACGGTGGGCGCATTGGTAACGCAGAGAATTATGTCAGCGATGAAGTCATGGAAAGCGTCAGTACAGCGGCGGTGGTCGCTCAC
GACCAAGCAGTAGTGACCGTGCCTCTAGTGCACGTAGGTAGACGACGAGAAGGTACGGTTCGTCCGGCTGCAAGCGTCGCCAGCCCAGTAGGTGCGACTT
GTAACAAAAGGCAGCGTGAGGAATGAGCGCGTGCCGTGACTAACTATCGGTTTGGTGTTGATGCAGGAGTTGACGGCAGCATCGTTGACATGACCGACGA
CGTCATGGTGGACGCTGAAGGTGCTGCCGACCAGGCAGGTGTCGCTGTGCCTATTGAGAACGAGCGTGGTGGACGTGGTGAGCGTGGTGGACGTGGTGCG
CGTAGTGCGCGTGGTGAACGTGGTGCGCGTGGAGGACGTGGCGCACGTGGTGGAAGCGGCGCGCGTGGTGAACGTGGTGCGCGTGGGGGACGCGGTGAAC
GGGCTGCTCAGCGTGCAGCTCGAGCCACAGGTACTAGAAATGGGGTGCTGGATCTCAGAGTGCAAGCAGAAATAGATAAGCTAATGGTGTGTTGCTGGTT
TTGCAGGAGCTGGTGCGCGTGGCGGTGATAATGGTGACACGGCTGGAGCAGTCGTTGTGAGCGCTGCTGCTAGCCGCGGCGACCGAATTCCAACTGATGG
AGTCGCGATCCCCGAATCACCACAGTCTGGGCGAGCAACAACCAGTGGAGTAACGGGTGCTACAACGACGCCAACACGAACACCACCCATCATGCTGCAG
GACGTGTACGTGAGCAAGCTGGTCGCGTTCTCGCCGGACAAGGAACGATGGATGAAAGCGAAGGTCTATCGGCCTATCGGTACTGCCTACATTGTTGGCC
GAGTCTACCGCCATGATCGCGACACCATCCGTGATCGTGTGGCTGGATTGATCTCCCTGGTGCAGCCCGGGTCCACTTCGGCACCAGCGCCGAGCTCGCC
CGACGCTCAAGGCAGTTCCAAAAGGCCCCGTAGTCCACGATCTTCGGCCAGTCCATCTCCTCCTCCTCCTCCTCGTCGATCGCGTTCGTTGGGCTCCAAT
TCGCCCCGTGGGCGTTCGCCTTCAGGGTCCAGCTCTGGGCATGTTAGCGGCGACAGTCCGTCCCATTCAAACGGGGATGGTCGATCTCAGTCCGGTTCGT
CATCGGAAAGTGATGACGATTCACTGCGGGCAGCGCTTACTGGTTCTCGATCTTCCCTCCGGCGTCGCTCTGCCGACACATCCACTGGTGGATCGCCCAA
TCGCCCAATCGATGTCGGGTCGCCCGACTCCTCTGAGGCTTCGAACGGGAACCATGGTCGCTCTGGAGATGCCGGTGGTGGTGACAGCCCCGGGGATAGC
AGTGACGATGATCATCAATCCAGCCACGGCGACAGCAGTGAGCGCAGCGATCGGTCGAGTGACAACAACAGCCAGGATGGCGATGGTGATCAAACTGCTC
ATACCCCTGGGGCGGCAACCGATCGTGACGCAGTTCAAGGGGTTTCGGGGGCAACCAGCCTGACAGTGATGACAGCGTGATCAGCGACCACGATCTCATC
GCAATCAACTTCTCAACCCCGGGCAGTTGGCACAGCTTGCGCCAACCACCATTCCTCGCGACGAGTGGATTCCCGGCTATCAAAATCGTGTTCGCCGTAC
TGCGGTTGACGTCGATCCGTGGCCGGCTAGATACGTCGGTCGCGTCAGCGTGCTGGAGATGGACGTCAACTTGCTTTTCCATCATTTCGCCAAACCGAAG
AATTGGTTATTTCCTCCAAGTGACCAGACTCCTCCTCCCAATCGGTGGTCCGAAGGGCTAATCACTGAGCTCCAGATCCTGGCCCTGTACGCGATTTCTC
CTTGGGAGAATCTGAACGTCGTCGTGACGCCAGTGTCGTTCGAGATGACGGGTTGGTTCACGACGATCTCGACCAAGTATTTGCAGTTGGAGGACGAACA
TCGGCAGGCCCTGTGGGAATCGGCCCACGCCTTCCCCATAAGTTCTGCACTTCGAAACTCGGATCCGTTCTTGGCCGCCTTCTGGGAAGAGCGACGTCAG
CGGCGGCCTCGTCTTGGTGCCCGCTGGAAATCGTTCTTGCGACACGTTCTCCGAGGGATGATCGACGGCCATTGTGATCTAGATCTGCTCCTCGATCCCT
TTTTTCTGCATTTTCCCCGGCTCGGCGAGAAAAGAGTGTGGTATCCCGGCTTGGGATGTTCCCCACGACCCTCGACCTTGGTCGATGCTCTTCGCGCGAT
TGACTTGGAGGAGCCGTGGCGTAA