Transcript Name :
Phyra_g18
Orientation:
(-)
Number of Exons:
1
Description :
hypothetical protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-4
5-27
28-77
78-100
101-130
131-153
154-155
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        467 bases(100 bases per row)
TGAAGTTCAACGTCTTCCTCCTCGCCGTCATCGCCATGCTCGGTATGATCACCGCTGCTACTGTCGACCAAGGTGCCGTCAAGACTCCCGCGGAAGCGCT
GGAGAAGATTCAGGCCTCTGACTTGCCTGCTGGTGTCACGCTCACGGGGACGACCGAGAAGATAGACCCACCTGCTTCCGCTTCAGCTGTCGCTATGAAG
GAATCCGACAAGGATGACAAAAAGGAGCAATTCGGCTGGGGCGTCGGTGGTCTCGGTCTCGGTCTCGGTCTTGGTGGTGGCTGGGGGCTTGGTGGTTGGG
GAGGGTGGGGTGGCTGGGGAGGCTACGGACCCTACCGCTTCGGCTTCATGTGCGGCGGCTACCCTGGCTGGGCGTACCCGATGGGCTACTGGAACATGTA
TGGTGCTGGTCTGTACGGCGGCGGCTGCGGTCTGGGCATCCCATTCGGCGGTCTCTACTACTGCTAA