Transcript Name :
Phyra_g29
Orientation:
(+)
Number of Exons:
3
Description :
hypothetical protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Ankyrin repeat-containing domain20.659PS50297
Ankyrin repeat12.396PS50088
HmmSmart predictionP-Valprediction_id
Ankyrin repeat2200SM00248
Ankyrin repeat0.0013SM00248
Ankyrin repeat560SM00248
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
Ankyrin repeat-containing domainIPR020683
*** None ***
InsideOutsideTMhelix
1-131
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
protein bindingGO:0005515IEA
*** None ***
*** None ***
Sequence
        955 bases(100 bases per row)
ATGACGCCGACTAGGAGGAAGGAGAAAAAGACCCAGCGCAGAGAGAAGGAAGACGCCGCTCGACAGTTGACAAGTTTGCTGTCTACAGAGAGCGACAAGT
TGAGCGAGCAGCTGCTGATTGCGAGCGAGAAGGGCAGGCAGCGCGCTGTGTTCCTGCTGCTGCATCAAGGAGTGGACAAGGACCGATGCAGAGGCCTCGT
ACGTGGCTGCCAATTGAGAAGAAGGACGAAGGTTGTGAGCTGACTAATTCGTGTTTGCATGTTGCAGCTCGGCTGCTCTCCGGTGCATCATGCCGCGGCA
CGAGGTCATTTGGACGTGCTGCAGCTGTTGCTCGACTTTGGGTGGGGTGTGGACGTTCGCAACGACGCGCTAGAGACGCCTCTGCATCTCGCGTGCTTCG
ACGGCCACGTGCACGTTGCAGAGCTCTTGCTAGACCGGGGAGCGGATGTCAACGCGAGAACGAGCGATCGAGAGACCCCGTTGTTTTACGCGACTAGGAA
GGGCCAATACAGAACGGTTCGACTGCTTGTCAGACGGGAGTGCGATCTTGCAGCGGAAAACTGCTACGGCGACGTGGCGGAAGAAGAAGCTCGAGATGCA
AAAACTCAAGCTGAATTTGCGTCTGGAATCGAAGACTTGCAGCGAACGTCAGCAGTAGAGGGCCAGCGTGGAAACAGCGGAGAGTATACGCTACCACAAA
AACTTCGAGAGCGAGTACTGTCATTTTTAGATCTGAAAAGTCTCGGGTTTGCTTCACAAGTGTCGTATCGATGGCATCGAGCTTCGGATAATTCCTCGTT
GTGGAAGAAACTCGGCGTATCACGGTGGGGATTGCTGCTTAATGCGGCGATGGGAATGGGCACGGTTCCTCAGATGTCGATGCTACGTACTGCTACGAGC
AATCTCTTACGCTTGAATCTCTCGACAACGGTGTCTCGGCGTCCATCGAGCTGTG