Transcript Name :
Phyra_g1
Location :
Orientation:
(-)
Number of Exons:
4
Description :
hypothetical protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-467
NN-scoreoddsWeighted Score
0.661.8740.004
PositionContextScore
168VSHRPKR|QN0.714
TypeScore
cytoplasmic34.8
GO
*** None ***
*** None ***
*** None ***
Sequence
        5465 bases(100 bases per row)
TGGTGTGGCTCGCCGGCTCGGACGTGGTGTTGACCGCAGACGTGGCTACGGCGGCGATCCCGACACGGTCACCAGCCTCGGCGGAGAGGCTGGGCATGGT
AACGGAGCCGCGCACGGACTTGGTGGCAGCGCGGTCTGAAGTCTTGGCCTTGACGTCCATGGCGGCACGGACACCAGACTCCGCTGCGAGGCAGCTGGTG
ACGGCGGTGTCACGGACAGACTTGGTGCGCATGACCTCGGTGTCGGTGCTGCTCGCGGGCTGGTCGGGGCTGTTGCTCGCGGACTTGAAGGAGGACCTGG
TGTCGGTGCCAATGGCGACAACACCGCCTGATCCGTTGGAAAGACTAGCCGATGTTGTGGTGGAGGGCGTGCGGCCGAGACGGGGAGGTGGTGCGTGCGT
CGGCGCTATTAGTCGCCAGGAAATGAGGAGAGATGGCGGCGGCCGCGCTCGCGCGACTAGAACTCCCCTGGAAGGCAGACCACTGAAAAAGCACCGCGGA
AAGCTGCTTATGGTCTTCCCGTACGTCCTCTTGAGACTGGCCAGCCGAAGACGGAGCTCGTTCGCAGAGCGCTTGGTTTTCATCCGACGGGCCACATATG
CCCAGGTGATGCGAAGGCCTTCCCTCTCGAACTGAAGTGTGATCTGGACCAGTAGCTTGTCTTCTTTGTCAGTGAAACTTGTGCGCATTTCTGCTAATTT
TTGTATGTGAAATGAAGTCAGCATGTAGTGCATTTGACTTACCTTATGTATGGCGATATGACTGACTGCACGGTGATACTGGTGCTCATTGTTTTTGCAG
CGCTTGGTCGATGACGCGGCGATGCGGCTTCGGCTGATTACGGCGGCTGAAGCAATAAAATACACCTCGGAGACGCGATCATTTGAAAAATACCCCCATC
CCTCTTAAAAAATGCTGTGATTGGTAGTAATATTGCACGGTAGGTCGAGAGCGGGATCAGGCTAAAAGGGCGCAAAAATCGCCCTTTTAGAAGTCCATTT
GTCACCGTGTTTTGGAAACAGCGTTAAAGGGCGAGAAATGCGCCCTTGCACCGCGAAAGTGTTAATTAATTAGCTAAGTTCGCTTTCGTTAATTTGCTTA
AGTTCCGACTTGCTTGAATATTTTTTTTCTTACGAGCACGAATTTCCGTTCGATGCTTCTCATCATATTCTCGCTGCTTCGCCAGTCGCGTTTCCCTTGT
CTTTAGATAGTAGCGCCTTGATGCGCTCTTTATTAAGTTCGTATTGCTCGGACGAGTACGCCATCTTACTATATTACTAACTTTATATTTATCAAAAATA
AAAATATAATACTTGGATAGCTGGCTTACCATTTGCTATAGTCTGGGCCCCACCACCCAAGATCTTGCGGATATGGCATTGATTTAATCCACTTCGAATG
TTTTTCTTTATTGCAGTGCTTTGCGAAATTCCATCTCTCCATCGATGATCCACACAAGCAAGTGATTCTTTCATCCATCGGAGCTGAAATTATCTTTTTC
ATCATATCTTCACTGACCTCTGGCGAGAAAATTTCAATGGAAGGAAACTTTGAAAATGGATGCTTACCACAACGCTCTTGCGATGGCTTTGCCTTACACT
TTAATCCACTATCCAAAACGTAGTTGCACATTCCTATTACTAGTAGTAATTGTTATATATACTTAGTATTTTTATTTTTGTCATCGGCTCTGTAGAGCAG
CAAGGCCATCAACATCCGTGTCTAGCTCATCGTTTCAAGACTAACTCCACGTACAGCTGTTTGCCACTGTAGATGAGACGAATCTGGTCCACCTGGATAC
CTTCTTTCTCCTGCAGGGCCTACTTCACATGCAGGATCTGTTCACGGAAGGAGAAACAACGTCAGTATCACACCGTCCGAAGCGCCAGAATATCGCATCG
TACCGTGTTGTCCGGCTCAAAGTTGAACGTCTGCTTCCGGCCAGTGAGCGTCTACACCAGCGCAATAAACACACTTATTAGTACCCTTCCAGCCCCTGTG
ATCGCGGCGTGGGGGCGTGGGTACCTTGATCTGGATCTGCATCTTGGCTTCTAACTTGGCGGCTGAGTGTTTCGAGGCAAAAGTGGCTGTGGTTCCGCAA
AGTTCTTCGCGGAAATTCGAATTGGGAAATTCGTGAAAGTAAAAACAATTGGTGATAATTGGTCCACTTATATTTCATCTGATAGTAAAATTTGACACTT
AACCCATTATTCCCCGAAGGGCATCTTGTCACCTCTGCGGATGCTGCGTTCATGAGAACAATGTTGAAGTGCGTGCAGGCTGCAGGACAACGCGTGCAGT
TAGACTTGAGAGAGCTGCACGGACAGACCTTACCAATGTATGGACTGAGCAGCACCCCCTCGCAAGTGCATTACACTTTCCTACACTTTGTGAACACGAA
AGTTCATCAAACAATAGCCGACATTCACGTATCGCCTCTGGATTTCAGACTTCGTACCCGGCATTGGTGAATTTGACACTAAAATCCGCTGAAAGTACTG
GTGATCGCTGTCTGCTTCAAAACATCTTCTTTCTCCGCCTTGCAGTCTTCTCGAACGCGAATCTAGGGTATGTAAATGATCGTGTTTCATTACAATAGCG
AGTGCGAATCACTATGTAGCGGTCGACAGACTACCAGTCCACCCCGGGAACGAATGGTAACCTGTCGTCGAAGCGGGGCATTTCAATTGCGGAACTTGGG
TCAGTGTGAACTCTTAGAGCAGGTATAGCCATTCGAGCCTGTGGTTTCAGCGTCCTCACAGCGCATAATTAATTATGCATGGTGCAACAATTGCATTGGT
CCTTGTTGGATTGCATTCTCCAACACAAATGCATTCATTAAATGAATGTACAATGTTGAGACGGCGGTGGAATGCTGGAACAGCAATGATAAAATCGTGC
ATCATTCTTTGGCTATGAATGGCTGTTAGGGAGCGATCACTCACTGCGTAAGGAAACCCCACCCACGAGCTGGAACCCAGCCAATATCCAGTCTGGGCGA
GTTGCACGACTCGGAACAGATTCATAAGTATCGAGTCTTGTACCTAGAGACGTGGAAGCAGGGTGCCGACGAGATGATTGACCGCATGGAAAAAACTCTG
GAGAAGAGCGTGCTTCGTGAATTTGCTGATCAGCAACAACGTGCAATGACTGGCGTGCTGAAGAAGTACAACGCACTGGGTGAAAGTTACGCAGAAATGC
ATGCCAAGTACTTAGCGATGTATGAACTACCAGCACGATTAACCAAGACACAGCATAGTCTCATGGTTCTTCAAGCCGAAAAGAGTGCAAGAAGTGGTGC
AGGAAATACAAGTGGGGAAACCGGTTGCGATTCAGATATCCCCCACGACCGGATAGATCAACTTGAGAACGAGCTACAGGCGCAAACGGAGCGCGTGAAG
ACGCTTGAAGTAGCTGATCGAAAGGCTGTAGTCGATTCTGACGAGTTAGTGCAGTTGCCACCGCTCAGAGGACGTTCTGGAGATGACAATGAGCTTCGAA
ATGAGAACGCGCTGTTGTACGAGAGAATTAACGAGGTGGGGCAGCTAGAGCAGCAGGAGGAACGACTTCGTGATTTGATGGCTTCCTCAGAAGATCACGC
AATTGTAGGCGAGCTCCAGCATCAGTTGATGCAGATCAAGACGACCTACCAGCAATTCCTTGTGCAGTACGACCTAGTAACGGAGACGCAACAACAAACA
CTCCTGAAAAATCAGCGACTTGAGCTGGAGATGGAGAAAAAGGCCCAGGAGCTATCTACAGTTCGTGAAAAGTCAAGCGATAAAGTCCAAATTCTCGAGA
ATGCGATCGGGCAAGTGAAAGAGCGTGACTGGACCGCGCGAAACACGAAGTGGGAGGCTTTCCGGAAGCGTTTAGATTCATTGGAAGACGAGATATTGGT
CGAACAGCAGCGCCGAAAGCAACTGGAGAAAGATTTGGAAGACAAGCAGACTCAACTACCGCTACTTGAGCTTAAGCAGCAACGTGGCAATCAAAGCGAG
GTTGGCCGGCTAAAGAGCCGGGTAGACGCGCTGGAAACTCGTGAGCGCTTACTCATGGGTCAGCTTGAGGCGGCGACAAAGGCGTCAGGGCCCAGGGAGA
AGGAAACCCGGCTGCAAACAGAACTTCGTGAAGCGAAAACGCTTAATGAAGACCTACTGCGCCAGCTGGAGACAATTCAAGCTCGTGTATCGGAACTGCT
GCGTCTAAATGGCGAGCTCGAATCGGGAAAACGTGAGCTACGATGTGAATATGAGGACCTGGAGCTGGAACTACAATACGTTCGTTCGGGTCTCACGGAT
GGAGAAGCGAGAGCACGATAAGAAAGAGCGCGCGAATATCCATTAGGGCTAGGTGATGAGTGCATCGTGACACTGCCCAAATATTATTTTGGCTGCTGTT
TGTTTGGCTCGGAAAGTCAAATGTCGGGCAACTTGGCCTCCAGTGGAGCGCGAATTGCCCACTTTCCGACTTTCCGGGCCATTTAAACAGCAACGTGGAG
GATCGGAGGTCTGCCGACATGATTATGCGTCGGATTATGCCGCGGTTACCTATCGGTTCCTGGGTATGGAACTAGTTCTCGGAACCGTCACTGATGAATC
AAATTTGAATTGATCATTTTTTTAGTGGAAGTACCAATTCAATTTGAAGTCAATTCATTCGTAGCGTGGACCACACTGGGCAAGGTCTTTCTTGTTTGCT
TCTGCCAGTGCGAGGAAGAACAGCATCGGCAACCATGACCGCAGCAAACGGCAAGAAGAAAGACCACGAAGACGTGCTTGCGCGACTGGTGCGTGACCTA
GAGTCGAAGAAGACTCTGTGCCGTGTCAAGGACTACGCTGGTGTGTCCCTCGAGCAGCTAAACCAGCACGTGAAGAAGTTCGGTCCGTTGGTCCATCCAA
TACTTGGCGAGCAGCCTGGTTTCTTCGTCGACGAAGGCCGATTTATTCCATTTCGGATGGTGGTGTTTGGGCGCAGCGTAATCGGACCATGCATCTGCAA
GGCACTGCTGGAATGGGCTGCGTGGAGTGGCCATGGTGGAAGAGTGACAAATGCGCTAGATGAATACGTGCTGGATGGCACAACGCTTCGGGTCCCCGAT
GTGGCGTATGTGCCTCGAGATGATGCAAGGCAGCTGACCGAAGCTCAACGATGGACTCGTGGTGGAGAACCTTTTGCTCCGACGTTCGTGGTGGAAATCG
ACACTCTCACTGGTCACATTCCAAGCTTGGTGCTCTCGATCACAAGATGCGGCACGAGTACTTCCCTCACGGTGTGCAATTAGGATGGCTCATTGATCCA
AAGAACAAAATCATGTGCGAATACAAGCGATGCGCCCGAGGAAATTGTCTTGTTCGACGCGTTGGCAATAGCGCGTGGAGAGATCTTGATGGTGGTACCG
TTCTTCCTGGCTTCACTGTTAATTGTGAAGATTTGGACGCTGTGTTGGACCAGGAATCCGGATCG