Transcript Name :
Phyra_g27
Orientation:
(+)
Number of Exons:
2
Description :
hypothetical protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-201
NN-scoreoddsWeighted Score
0.8911.9920.004
*** None ***
TypeScore
mitochondrial56.5
GO
*** None ***
*** None ***
*** None ***
Sequence
        701 bases(100 bases per row)
ATGGTATCACGAGGCTCGTCAATCCACCACACGCGGCGCACCAACAACCCGTTCATGACCACGAGCTCTGGGATCGTGGGCATTGACCTTAATGAAAAGG
TGACCTTCGACGCCCCTCGGCTCCGCACCAGTTCTAGCAACAACCAGATTGGCACTGGCCAGCCACGCTCTGCGAACGCTTTGACCGAGTTCATGTACCA
AACGACGTCGGGGGCTCTTGGTGAAGGCACCCGCGCGCAGGAACGCCTGAGACTGAGCCAGCGGATGGATAAACTCACCGTACACAAAGGTGCGTGCTGC
AGCGGCTTCACACTCGATCCAACCTGGAACTGCTAGGGATACTAACGTGATACCTGCTACCTGCTCGTTTTGTGATGTTGAATAGAGGTGGAAGCGTCTG
GCCTCGTCACCATCCGACAGGTAGACGTAGCAGCACCAGAAGACTTTGCAGTCCGCCCAGAGGATATCATGCCCAAGGCCGTCGACATCAAGTTGATCAC
TGAAGCTCGAGGTGAGCATCCTTTGTACGCCACCAGCAATCGAGAAATCGGCGCCGACAAGGCACAGCTGAAGGTCGAGATCGAGCGGCTCGGCCGACCA
AACACTTTCACCACGTCGTTCAACGGCTTCCGATACCGCGACTTCGGGCTCAACACTGCCGTGACCAAGTCCCGCATCTGCGACCAGCTCGACTACTCTT
G