Transcript Name :
Phyra_g26
Orientation:
(-)
Number of Exons:
2
Description :
POM80049.1 3-oxo-5-alpha-steroid 4-dehydrogenase/steroid 5-alpha-reductase [Phytophthora palmivora var. palmivora
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
3-oxo-5-alpha-steroid 4-dehydrogenase, C-terminal16.219PS50244
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-6
7-29
30-61
62-84
85-104
105-124
125-174
175-197
198-230
231-253
254-289
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
integral component of membraneGO:0016021IEA
cytoplasmGO:0005737IEA
lipid metabolic processGO:0006629IEA
*** None ***
*** None ***
Sequence
        945 bases(100 bases per row)
TGATGTTCATTGGGATGCTGGAGCTGTGGCAGCTCACGTGGGTTATCGCAGTGGCTGGTGCTCTGCTGTCGTTTCGCAGTGGAGCATGTCGGGGCTTCGT
TCTGCAGGGCAAGATGCGCACCCCCGTGGCCGTCGCGCAACTCCCCGGACTATCATTGCTGCGCGTGGAGGTGCCAAAGAGTTACTGGACGTGGTTCTAC
CTCATCGGAGCACTACACAGCATGTTGGTGCTGGTTGTTGCAGTCTTTTGGCACGACACGCGAGTGGCGCAATTCGCTCTGCACCTTGCGCACCCGAGAG
CGGACCAAGACACTTTGGTGGTGGTCCAGCCGCATACCATTACGTTTCTGGGACTCTTTGCGGTGCACACGACACGGCGCTTCTTGGAATCTCTCCTGAT
GACGGAGTTCGGTGATGCCAAGATGCATGCGTGCAGTATGTTGCTGTAGTTCTCGTCTCGCTTGACGATGCACTAACAGTTTGATGGTGGTGGTGACAGT
TTTGTTTGTAGGCACCTACCACTACGTTGCAACTGTGCTCTCCGTCCTCTTCGACCCGGACGCAATTACGTTGCATGAGAACTCAACGTCGCGCCAAGTG
ATGGCTGTGGCTGGAGTTGTAATCTACCTCGTTGCGACCTACCATCAAACGCGCTGCAACTACTTGCTCGCGAAGCAGAAGCGCGCTAACAATATGAAGC
ACGTGATTCCCCGTGGTGACTGGTTCGAGACCGTGCGAAGTCCGCTCTACACGACCGAGATCATGCTGTATGGTGGATTTATCCTCGTCACTGGTGGCAC
AGTCTCCATGATCTACCTCATCTCCGCCTGGGTAGTCGCCAACCAGCTTCTCCTCGCACATATCAACTCGCAATGGATCGAGGACAAGTTCCGCGATCGA
CTCCACGAGCTCCCAAAGTGGAAACTCTTTCCACACGTGTGGTGA