Transcript Name :
Phyra_g25
Orientation:
(+)
Number of Exons:
9
Description :
hypothetical protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
fprintscan predictionP-Valprediction_id
G10 protein8.3e-28PR00322
G10 protein8.3e-28PR00322
G10 protein8.3e-28PR00322
G10 protein8.3e-28PR00322
G10 protein8.3e-28PR00322
Profile scan predictionP-Valprediction_id
ABC transporter-like19.141PS50893
ABC transporter-like17.12PS50893
HmmSmart predictionP-Valprediction_id
AAA+ ATPase domain0.000000000018SM00382
AAA+ ATPase domain0.0000037SM00382
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-134
135-157
158-189
190-212
213-266
267-289
290-308
309-331
332-345
346-368
369-374
375-392
393-524
525-547
548-871
872-894
895-994
995-1017
1018-1048
1049-1071
1072-1080
1081-1103
1104-1115
1116-1138
1139-1152
1153-1175
1176-1228
1229-1251
1252-2389
*** None ***
PositionContextScore
188LVLRRRR|PV0.536
2003SECRTAR|LV0.627
*** None ***
GO
Biological ProcessGO IDPrediction Method
ATP bindingGO:0005524IEA
ATPase activityGO:0016887IEA
nucleotide bindingGO:0000166IEA
nucleusGO:0005634IEA
*** None ***
*** None ***
Sequence
        11864 bases(100 bases per row)
ATGGCAGACGCTGGAGGATCGTCGGACGACGCCGAGAGCGCCACCCTCACGGCGCTCTCCGACTGCGTGGCCACCGTCCTGGAGAACGACATCTCCTACG
GACTGTGCGTCACCAACTCGGGGCTCTTCGACCTGGTGCCGTCGCAGCTCCAGGGCAACAATACCAATGCCTCCTCCTCCTCCTCCTCTTCTTCCTCCTC
CAATGAATTCAACGGGGACTCAGTGTGCCGCATCCTGTGTTCCAAACTCTCGACGTCCGCTTCCTCCTCGTGCTGTGACGCGGCCGCCTCGCTCCAGTCC
TGCAACACGACGTCGTCGGCCGTCACGTCCTGCAAAGAGCTCTTTGACAGCGTCTTCACGTACCAGAACGAGTGCGACGGAGGCCTCTCCTCCGCTAATA
CAATATTAATTGCCGTCGTGGTCGTGGTGGTCGCCGTTGCGGCATCCTTCACGCTGCTCTCGAGATGCTACGGTCGCAGCCAGGGACTTGCAGCCAAAGT
GGCGGCCACCTGCAGACAAATCGCCAATTTGGTGTGGAAGAACTTGGTGCTGCGACGTCGACGTCCCGTGTCATTGGCCTTGGAGATCTTACTGCCCGTG
CTGTTGGCCTCAGCGCTCTTGGTGCTGGCCAATCTCGACAACTTCGCGGGAGGGTGGAGGGCCTCGTGGTTCACGTCGGAAGCTGCGGTGCTCGACGCGA
ACGAGACGCTCATTTGCAGCGACGTGGTGGTGTGGGGGCTCGAGACGATTGGAGGACCGTCGTCCACCATGACATCCTTCTTCTCAGGGGGGCAGTCGGT
GCTGGGGCTCTTCTTCTTGGTGAGTTACATCAAGTTTGTGTCCACGACCACGACCACGATGGTCATTGAGAAGGAGAACAGGCTGCGGGAGGTCATGAAG
ATCATGGGACTGTCGGATGCCACGCTGCTCTGCTCCTGGTGTGTCACGACGGCACTGCTGTCGACGCCTTTGGCGTTCGCGATCGCTGCGGAGCTCAAAT
ACGGCAACGTGTTCCCCACGACCGAGTACGCGACGCTCGTGTTCCTCTTCTGGACGCTCAGTGTGGCGATCACGGCCTTCTCGTACTTCGTCGCGCCCTT
CTTCAACAAGTCTCGGACGGCGGCTATTGCGTCCGTGTTGCTCTGGCTTATTCTGTTCTTCCCCTACTTCGCAGTGCAGTCCGCTGATACAAATGGACCG
AGATACTGGGCTGCCTTGGCGCCGCCGACTGCGTTCGCGCTGGCGATAGACGAGATCCTGCGTCGTGCTCAACTCGGGACGGGATTTGCCTATTCTGTCG
GCCTTCGAGAGGAGCCCGTGACAGTGCCAAGCGCCTTCAGATGAGCCTGTTCCTCATTCTCGACTCCGCCATTCTTGTGGCGCTGGATGGTACTTGGAGC
AGGTCCTGCCGCAGCAATACGGCATAAGGAAGCCGTGGTACTTCTTGTTCACGAAAAGCTACTGGTTTAATAAGATTGATCACGAACCAGCAAGCGCTGA
GGAGCAACAACTCCGTCGCTGTCTCCTCAAGCAGGTGGAGTCTACACACAGCTTACTGACGGAAAGATCACGGTCCAGACGCTGGAAGTTGAGCCTGGAA
ATGCATACGTGGAGCCCGTCAATGCAACGTTGGCAGTGCAAGAACGCAATGGCACCTGCCTACAGATTCGCGGACTGCGAAAAGTGTTCCCGCTCGAAGA
AGACGGCGAGGAGCACGTGGCTGTTGCTGGATTGGATCTGGCCATGTACAGCGGTCAGATCACTGCTTTGCTCGGACACAATGGAGCTGGCAAGACGACG
ATCATCTCGATGCTGACGGGTCTGATCCCGCCGACGGCAGGAGATGCGACCTTGTACGGGTGCTCCATCAAGCGAGACTTCCACGAGCTGCGGCGCGTGA
TTGGTATTTGTCCTCAGCACGACGTGCTGTTTCAGGATCTGACTGTAGAGGAACACATGCTGCTCTTCGGCACGATGAAGCAGGTGCCACGCCACAAACT
CCAGAGCAGCGTGGACAAAATGATTGAGGACGTTGGACTGACGGAGATTCGGAACGCGCTCGCGAAGACGCTCTCAGGCGGTCAAAAGCGCAAGCTCAGT
GTTGCCCTCGCGTTCCTTGGGGGCAGCAAACTGGTGTTTTTGGACGAGCCCACGTCAGGCATGGACCCATACTCTCGGCGTTTCACGTGGAACTTACTCC
AGCAGAGCCGAGAGGACCGCGTCATTGTCTTGACGACGCACTTCATGGACGAGGCTGACATCCTCGGCGACCGTATCGCAATCCTGGCTGACGGTCAACT
GCGGTGTGCCGGATCATCGCTGTTCCTCAAGAACCGCTTCGGTGCCGGATACAACCTGACAATGATCAAGACTTCGAATGGCTCGTGTGACGTACACTTG
GTGCAAAGCTTTCTCAAGAAGTACGTTCCTGGCGTCAAGTGTCTAAGTAGTTCTGGGTCGGAGCTTGTGTTCCAGTTGCCGACGGCATCGTCAGAGGCGT
TTCCTGCTATGCTCGAGCACCTGGATACTGAAATGCACGAGCTTGGTGTGCAGCAGTACGGCATTTCGGTGACAACTCTGGAGGAAGTCTTCCTGCGTAT
TTCCCAGGACCATGACCAGCAGCAAGAGCAGCACGAAGCAGATGGAGAGGTCGTGTCCTCCCTATTGGAGCGAAAACCCTCGGCTTCGGTGGTGGGTCGT
ACATCCCTGAAGCTGGTATCGGCAACAGGTGTGGTGAATTTGCCATCGACTGCTCCACCGATCACCGAGCCTACGATGTGGATGCAGTACGTGGCACTGA
TGAAGAAGCGTTTCCAGATTGCCAAGCGTGACAAGAAGACGTTGGCGTACTCGGTGGGTATTCCGCTCATCTTCCTGATCATCCTCGCAATTCTCCCAGA
GATCCAAGTGGCGGACTTCATTCCCAACTACACGTCGAATCTCCCCACGGATGCGCAACAAAGCCAATGCGCTGCGTCAACCAACTTCAGCAGTCTGGTG
GACGCAGATTACAACGTTTCGTCATGCATGAGCTTCCGTGGCTTCGACTACTGCACGCTCGGCGTCATCGACTGCGACGTCAACGTGTGTTGCGATGCGG
CCAACATCGCCTCGCCATGGTATCCGTGCAACACGTGTGGGTCGTCGCCATGCTACAACAACAACTGCCTCGCGAAGAACAACGCGAAGCTGCAAGTGAC
ACTCAACGGCTTCTTGATAGCGCTCGTTGTGATGTTGGCATTCGCCTTCATCCCTGCAGCTATCGTGGCGTTTGTCGTCCGTGAGAAAGACCCCATCCAG
AACGCCAAGAGCTTGCAGCTGATCAGTGGCGCCAATGTGTCTGCGTACTGGATGGCGAACTGGACACATGATCTCCTGCTCACGATCATCCCGATTGTGG
CTGCTGCGATTATTATCCCGTTGTCGATGGTACCAAGTGGAGCGGCGAATGCTAGCTCCGCCGATGTGTTTGCCGTCATTGTGCTTGTGATCGCGCACGT
CTGGGCGATTATTCCACTAGCGTATCTGTTTTCGAGGCGGTATGTGAAGCACGCTGTTGCCCAGACGGCGCTGCTCGTGTTCGCCTTGGGCACGGGCGGC
TTGCTGAGTATCTTCTCGTTCATGTGCCGCATCGTCAACTTCACCATCTCGGGCTCTTTGACGCTTTCGTCACTCGACCAGAACTACTTTCGATGGATCT
TCATGATTTTCCCGGGCTACACGCTGAACAACGGCATCTTCGAGCTGGCCACGCGCAAAGTGAGTCGTCGGGCGATGTTCGGCTCGGCTCGCTGGCTTCA
GGCGTCTCCGTCCTTCTTCGGTCTGTTCGAAGGTTTGGGCAAAGAAGAGTGCATGGAGTGCTGGGACCGAAACGATCCCTCTTGCTGTGTGCGGCAGCCG
TTCGATTTGGAGATTGTTGGCGCGCCGCTGATGTACACGGTGGTCGAGGCTGTTGTGTTGTCTGTGCTTGTGTTCGTGCTGGAGAACCGATCGGTTCGGT
GGAACCAGACTGGAGCGAGCCAAGACGAGAAAGCGGTTCATAGCGCGGTTGGTGTGGATGCTGCCGACACAGCGGACGAAGAAGAGGACGACGACGTGCA
GCGTGAGCGACAACGCGTGGAGCATGAGGCTCCGCAGACGAACGATCTTGTGTTCATTCGTAACTTAAGACAGCAGTACGCTGGCAAGCCGCGAGCCAAG
GTCGCACTGAAGGACTTGTGCCTATCCATCCAGAGCGGCGAATGCTTCGGCTACCTTGGTATCAACGGTGCCGGTAAGTCAACTACGATGGCTGTGCTGA
CAGGTCAGCTAGCACCCACACAAGGCTTCGTCACTTTGAGCGGGTTCGATCTGTCAACCAGTTCGGCGGCTGCACGGAAGACCATGGGCTACTGCCCTCA
GTTTGACGCACTGCACGACCTGCTGACCGTGAAAGAGCAGCTGGAGTTGTACGCTCGGATCAAGGGCATTCCCGAGGCTTTCGTGAATACCGCAGTGGAC
GAACAGATCCAGGAGCTGGGTCTCTCGAAGTACCGCGACAAGCTCACACAGGGTCTCAGCGGCGGCAACAAACGGAAGGTATCGACGGCCATCGCATTGC
TTGGTCGTCCACGTGTCGTCTTCCTGGATGAGCCGTCGACAGGCGTGGATCCGAGCTCTCGTCGAAAGATGTGGGACGTCATCGCCCGCGTGTGCTCGAC
TGACAAGGATGACAACCGTGATGGCGGCGCCTGTGTCGTCCTTACCACCCACAGCATGGAGGAATGCGAGGCACTTTGCTCTCGAGTGGGCATCCTCGTG
AGCGGGCGACTCAAATGTCTTGGTAGCGTCGAGCACCTCAAACAGAAGTTTGGTCGGGGTTACACTGTGGAAATCACCCTTCGCGCGTTGACAAGCTCAG
TGAATGCCGATAACACGGAGCTGAAGAGTGTGACGGATCAAGTGCTGGCGTTCCTCTCTGCCGAACGGAGTCTGTCAGCACGTCGCAGTGAGAGAAGCAG
TCAACGACAGAGCTCAATCAACACCGCCACCAACGGCGGGGCGAAGGTCACGTCCGCCAACATCCAAGAGCTGTGCATAGTCCTCGGTGCTCCAGAACGT
GGTAGTAGCATTTTGGACCACACCGGCACAGGTTGGTTGCTTGGCAGTCAGCTGGAAGCGCAGGGTGCGATCTCCGTCGACAGCTTCTGTTCGTGGTGGG
TCTCCGAAACCCACGGCGAGAAGCTGCAGAAGTTTTTCCACGATAAGTTCCCGGGTAGTGTCCTCGCAGAGCAGCAAGGTGAGCACTTCCGTTTCCAGGT
GCCCAAGCTCCGACCGGATAGCTCCGACGGCAGTGCAGCGTTGCGTCCGGCCGAGATTTTCCGCGCGCTCGAGCACACGCGCTCAGACCTCAACGTGGAC
GAGTACAGCGTGAGTGAAACTGCACTGGAGCACATTTTTAACAACATGGCGGCGCAGCAGGACGAGGAGAAGGGCGTCGCACACGGCATGTATCAGTGAT
GAGCAATTGAACCTAAGTAATATTCTCGTTGATTCTTCTCGTCGGATGAACTTGTACTTCATTTTAATGAGTACTGTTGTGAATTACTGGTCCTCACCGG
TTGCTACTGTTGCAGTTTAGCTTTTGTCTTACAGCAAGTTGAAGTGTAGATACACAAAATGCTCAGGAGCTGGGAAAGGAGAGAGAAAAGCAAAGAGGGG
GAAAACCACACAACAGAAAATACAACGGGAGCAGCACGTCGCTTTACTCCCTCGCCCCGTGTTCGTCTTCTCTTTCTTGTTCGTTGTGCGGTGTGAGTTG
CTGACGCACGCAAAAGCAGCCAAGTTACAAGTGGTTATGAGCCCAAGGCTGGGTTGGTAACTCCCCGACGGTGAAGATCATGAGTACAAGTGCAGACACG
AAGAAAGAGACGAAGGAAGAGAAAAGGCCGCTCACCCACCGTTCGATGGCAAGGACTTCGAGGTGTGGTTCGAGCGCATGAAGTTGAAGCTGGAACGCAA
GGGAATGTGGAAGTACTGCGTGAAGGAGATCGAGGAGCCGGAGGAGTCGAAGCAGAACGAGCACGACGCGTGGATGAAGGACTCTGCGCGCGCTAAGGAG
CTACTCTATGACGGAATGACGGACAAGATAATGAAAACGGTGAAGTTTGAGCCGACTGCGTTCCGTGTAGTGGAGAGACTGAAGCAGAGATTCGTCGGGA
AAACGTATTTCAAGTATGCAGCGGAGATGACACAGCTGAGGAAGCTCCGACTCCAGGAGAACGGGAATATGCCCGATCATTTGGGTGAAGTGCGAAGATT
AATTGATCGAATTGCTCTATTGGGTAAACCTCTTGATGAGTATGAGAAGCCTGCGATTTTGATCGGCACACTGCCTGACGATTACGATAACGTGGTGGAA
ACATTTCTGGCAAGTCACGTGCCTCGAGATGTAAATGACCCTCCCAACTATGATCAATTGGAGCATGCATTGGAGCTCGCGTATGATCGGCGCCAAGGAC
GAAAGCTAAATGAAGGCAACGAAGATCAAGCCTTGTTTGGAGGATCTGGTAGAGGTCGGGGCCGAGGTCGTGGTCGCGGTCGTGGCTCTGATCGTGGCCG
CGGTGGCCGGCAGTGGAGGACGTGGCCGAGGCAGAGGTTTTGGTCGTGGTGGTGGTCGAGGAGGTAGCCAAGGAGCTGGACGCGGACGTGAAGGTCAAGT
CACCAGTAAAGGAAGATGTTTTCATTGCGGAGAGCAATCGCACCAAGTGCGAGACTGCCCGCACTTACCGCCAAGTGGTGCCCGCGGATCCGAGCCACCT
CAAAAGCAAGCCAAGGTAGAAGGAGCGCAGGGGAAGCGAGCTGCAAAGAACCAGTATACTCAGGATGAGAGTGATGAATCGGCATATGTGGTTAGTGCTC
TCATTAAGCAGCCTCCCAACGTGCAGAAGTTTGCAAGCAAGCGCTGGTACTTGGACTCGGGAGCCACAAGCCATTTGACTAACCAGAAAATTGATTTTAT
TTCGTTCACGGCCATGAGTGCATTGGTGAGAGTTGGTGGTGAGAACTGGTTGAGTGTAGCTGGAATTGGCACCGTGAAAAAGGAGATCCAGACTACGAGT
GGGTGGCGGACGTTAGTACTGCGTGGAGTACGCTATGTACCAGAACTGCAATGTAGTTTGTTCTCAGTGCGGCGACAAACCGCACAAACCCTGCCCGCAG
ATGAGAAGGTTCGAGTTCACTTTGATGACGATGAATTCGCAAAGGTGAAATTTGAACAAGGAAGTGCGAAGGCACATGTCGACAGAACCAATCTTTATTG
CTTAGAGCTGGAAAGTTCTGTGAACTCCGCATTGGTCGTCGCCACGGATGGAGACTACAAGTGCAGCTGTGGACACGCGCCTTGGTCACCCAGGACGGAC
AATATTCAACGCACTATTTCGACATGCAGATTGGCCGTTGTTAGCTGTGGATCTGAGGATCAGACAAGATTTCAGCTGTGAAGCATGTGTGAGAGGCAAG
ATGACGAGAAAGAGTTTTCACTCGGTGCAGAGTTCGAATCGTGACTGGTTAATTGGAGAACGAGCACACGTGGATGTTTGGGGGCCGTATCCAGTGGCGT
CATACTCGGGCATGCGCTACTTTGCTCTCTTCGTCGATGAGGCGTCTCGCTTCTCGACTTTGTTTCTGATGAAAGAGCGCACCAACGTCTACGCAAAGTT
CCAGTTCTACTATGAGCGAGTAAAAACACAATTGAAAATCCGAATGAAAGAGCTTCGTTGTGATAATGCTCGCGAACTACTAGCGCTCGGTGAAAAGTGC
AAACGCACGTACGGAATGGAGTGCTCGCTGACGGTGAAGCATACCCCAGAGCAAAACGGAGTTGCTGAACGAATGATTCGCACGGTGACTGAGAGGATGA
GGTGCTTGCTGGAGCATTTCGGACTGCCCAAGCAGATGTGGGCGGAGGCCGCTGCCACCGCAGCGTATTGTGTAAACATAGTGCCGAACAAGAGAAAAGG
AATGCAAGTCCCGTATGCAGTGTGGTTCAGAGAGACACCTGCGTATTCGAGACTTCGGACATTCGGTTGTGCTGTGTTAGCTTACGTTGACAAAGTTGAG
CGCAAGAAAATGGATTCACGAGCAAAAGAAGCTGTATTTGTTGGTTATTCTCGTGAGCGAAGAGGCTATCGGTTGCTGGACAGCAAGACGAACAAGGCGT
TCTACAGCCACACAGCGGTCTTCTATGAAGATAAACCTGGACGAATCCTGTTGAAGGATGGTACAGAGGCACCAACTGTCCCCACGTCGGAGTATTTGGA
CATTAATGCTACGACGATGCAGAATATCCCAGCTTTGCTGGAGGAAGCTCAAGCTGAGGAGATGCCTGACTCAGAGTGCAGAACTGGTGGGGCTAGTGGA
GGTGCAGTGCCAGCTGAGGTTGCAGATGAAAGTCGTGCACAGCATTAGTGGTGCTTCTCGTGAGACTACTATATCACGAAAAAGAGCGCGAGCGAGTGGC
ATCTCGGCTCCGCGCAAAAGAGTCCGCATAGACGAAAAGGTGGCACCAGGTGCAGAAGCAGCACCGGTGAAGGAAAATGCTCATCGTCAGAAGAAAAGAA
AAAGAGGGAAAAGAAAGAAACCAAGTTGTGAACGGTGCGATACACCAAATGAAGAGTCTGATGGTCCGGGCAGTAGGCGGTGTGCGACACCGGCTGTAGA
GCAAGATGATAAGGAGACTGAAGGGCAGCAATCTTCCACTCGTTTGCCTGGTGCGATAGCGACCACCAGCAACGAGACGCTGGATGCTGATGGTGACTCG
CCGATGGGGGACCTTACCGTCTCTGAGCAGCGAGATGCACCTCGCAGTAAGGCATCGAAGACTGGCTGCAGAGAATACCGGACGAAGAGTGGCCGAGTGT
CGAAGCCACCACGGTGGCTAAGCGACACCATTCATCTTGCATACGGAGACTCAATTGAGAAGAAGAGGTCAGCTGGTTCATCAAGCTGGGAGGTGAAACG
TGATGAAATGCAGTTTGAAATCGCAAAAGAGAAAGCAATGGATTGGTGGCAAGATTTATGTTGTCTTTCGGCCAGTATAATTAATGAACCAGAGACCCTT
GACGACGCAATGAATAGTGAATACTCAGAGGAGTGGCGATCAGCAGCAGACATCGAGTACCATGCATTGAAGAAAAATGGCACATGGAAGCTGGTCCCTC
GACGGAAAGGGATGAAGGTGCTCGGAAATCGGTGGATATTTCGTGTAAAGTATCTTCCTAATGGCAAAATTGAGAGGTTCAAAGCCCGACTGGTGGTCAA
GGGCTTTATGCAGGTCTATGGCGTGGACTACCTTGAAGTATACTCACCTGTGGTCCGCTTGGAGACTCTGCGGATGTTGCTGACGCTGGCTGCAATCTGG
GACTACGAAGTCGACCAGATGGACGTGACGACCGCATTCTTGAATGGCCCTATCGATAGAGAGGTGTACATGGAGCAACCAAAGGGGTACGAGGAAACAG
GAAAAGAGGACTGGGTTTGCATGCTGGATAAAAGCCTGTATGGCTTAAAGCAAGCCCCTCGTGTTTGGTTTCGCCTACTGAAAGACCACCTAGAAAAACA
AGGCTTTACAATAATGAATTGTGAGGCTTGTGTTGCTGTGAAAGAGATTGATGGTGAGCTGGTGTTTATCTCCATCTATGTGGATGATTTGATTCTCTTC
GCCCCCAACAAGAAGTTGATGAAGGAGCTGAAGCAGATGCTTCACGTGCGTTTCGAGATGAAGGACTTGGGGCCGATTCACTACATCTTGGGCTGGGAGA
TAATGCGGAACAGAATGGAGCGGACAATTTTCATCAACCAGCACAAGTATGCTGACAAAGTATTGCATCGATTTGGAATGGAAAGATGCAATGGCTGCAA
AGTGCCAAGCACTCCTGACTTGAAGCTATCGAAGGTCATGTGTCCGACCACGAAAGAGGAGAAGGGCTTGATGAGTGGAAAGCCGTACCGGGCTGTAATT
GGCAGTCTAATGTACTTGATGTTGGGCACACGCCCTGATTTGGCTTACCTGGTCCGTGAGTGCAGTCAATTTCTCGAGAACCCTGGAATTTTGCACTGGC
GCGCTGCAAAGCGTGGGCTACGTTACTTAAAGGAGACGCAGGACTGGGGCCTACAATTAGGAGGAGTGCAATGGAGTCAGCAGGAATTGAATGATCATCT
CAAAGCTTTTGCAGATGCAGACTTTGCGAACCGAGTGGACGATCGGAAGTCTATTGCTGGGTATCTCACCCAGTTCTGTGGCAGCACCATTTCTTGGGCA
AGCCAGACAGAACGAACGGTCGCTTTGCACACGACAGAAGCAGAGTACATGGCGCTCAGCCTTCTTGTCCAAGAAGTCATACACCTGCGGCAGATGTTGA
AAGAGCTGAAGGTAAAGCAGGACAACCCCTCAGATGTATTTGTGGATAACGAAAGCGCTCGAAAGTTGGCGAACAACCCTGAATTTCACAGTCGGACAAA
ACACATTGATGTGCGACATCATTTTGTCCGAGAACGTGTTGAGCTGAACGAGATCACTGTGAAACGAGTCGCTGGGACTGACAATGTGGCTGATGCATTC
ACGAAGCCACTACCTCGTGTGAAACTTGAGCAACACCGAGCAAGCATGGGTTTGATTTCCCAAGGGCAATACGAGACTACCAAGAACTTGTGCAACGTTG
ACAACCAGTAGGTGGGGCTGTTGTGAATTACTGGTCCTCACCGGTTGCTACTGTTGCAGTTTAGCTTTTGTCTTACAGCAAGTTGAAGTGTAGATACACA
AAATGCTCAGGAGCTGGGAAAGGAGAGAGAAAAGCAAAGAGGGGGAAAACCACACAACAGAAAATACAACGGGAGCAGCACGTCGCTTTACTCCCTCGCC
CCGTGTTCGTCTTCTCTTTCTTGTTCGTTGTGCGGTGTGAGTTGCTGACGCACGCAAAAGCAGCCAAGTTACAAGTAGTACAAAGACCGTCTCAAAGAGG
GGGAGACAGTAGAGTACGCCCGTGCTTCCGGCGTTGGTTCCGTCATTGCGATTCCTGAAGTGTGACACATAACGGATACGACTGAGCACAAGTATAACAG
GTTGCTATTTTTCGACATACAAAAAACGAGTCACGCGACGACCCTGTTGCATTTCCGATAGTGTGGGCCATGTCCAAGTGGAGCAAGAAGAACCGCGCGC
CCGCGGGCTACGCGTACATCGAGCCGGTGATGGACGCGCTGGAGCGCGAGCTGCGCGAGAAGATGAACGAGCCGCACGAGGGCAAGCGCCAGTGCGAGGC
GCTGTGGCCCGTGCACCAAATCAACTGGCAGCGCAGTCGCTACGTGTTCGACATGTTCCACAAGTACCACAAGATCCCGCGCGAGGTCTACGACTACTGC
GTCAAGCGCAAACTCGTGGACGCCAACCTCATCGCCAAGTGGAAAAAGCCGGGCTACGAGCGATTGTGCAGCACCTTTGCTATTAACCCAAAGAACTACA
ACTACGGCACCGTCAGCATCTGCCGCGTGCCGAGGCAGCAGCTCTCGGAGGGGCAGGCGGTGCAGGAGAAGCACAGCGGCTGCAGAGGGTGCGCGTCTGG
ACCCGGAGGGTACCACAACATCTTTGGCAACAAGTACGGGCAGTACCTGGCCCGGATTCAGATCGCCAGGGAAGACGCAGCCAAGGATGTGAAGCAGATC
TGGGCCACGGAGGAGGACGAAGACGGGAGTGGAGAGGAAGATAAGAAGAGGAAGAGGCAAGAACCGACCCAGGAGAGCGAGAGTGAGGAGAGTGAGGACA
GCGAGAGTGAAGAGGAAGAGACCAAGGAGTCTGAACCCCCATCCAAGATGCAGAAGGCGGAGTG