Transcript Name :
Phyra_g22
Orientation:
(+)
Number of Exons:
2
Description :
XP_009530976.1 hypothetical protein PHYSODRAFT_462099, partial [Phytophthora sojae
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-461
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        1515 bases(100 bases per row)
ATGGAGACCGTCGAGGCCCAGAAGCTGCTGGCGGAGCTCCACGCGGCGGAGGAGGAGCACGCGCGCGCTCTCGCAGCCGCCAACCAAGTGCGCGACACAT
TGGATCGTACCCGGAAGGAGTACGAGGATGCGCGCACCGCGGAGAAGGCTGGCGAGGACGAGCTGGCCAAGGCAGCGGAGGCGCTGGCGCTTGGACTGCA
GAGTCTCGACGTGGCTGCCAAGGAGGACGCGCCGTACCCGATAATCGCAGACTCGTTGGTGGAATACCACGCCAACATCGGCTGCTACCAGTGTTATTTG
TTCCTAGACAGCCACAAAGACGGCGAGAAGCTGGAGGATGCGACGTCGGAGCTGGACGTCAAGAAGCTCAGCGTTCGAGTGGAATTCCCACGTGTAGAAC
TCACATACAGAGTCAGTGATAGTGCAAAGGACGCTACAATTGTCTGGTGCACGGAGATCGAGCGGAACGTGGACGTCTCGCAGTGTGTGGTGGAAGAGAA
GGGAGATCACTGGTACCTGCGACTGCCGATCTGGCCTAGTGACAAGCAGCCGCTGGGCGGGTTCTCGTCATTTACGCAGGTGTCTCCTGTCGAGCTCCGA
CCGGAGAGTTACGTGTCTGTCAGTTGTCGAGGATGCAATGAATTGCTGCTTGGTGGAGAGGAGATCGCGGGTATTGAGAAGGTTTTGCCGCTGCCATCCG
CCAACTGGATGGACATGTTTGACTTCTGGGGAGCTGGTATTGGCGCCTTTGAGCATATTCCGAGGGATGATATCCATGCCCAGCGACGGCGTGTGCTTGT
TGGCGAGTCGTATGTGCTTCTACACGCTAGTGATTTAATAGCTGGCGCGACGGTGTCCGATCATGGGGACAAGGCGGCGGTCGCACCCGGAGATAATGCG
AAGGAGGAGCGCGAGTGGGTGCCATTGGTATGTACTGCGTGCTCAGAGCGGGTCGGCTTGTGCAGTGTGGAGCAGCCGGATACTGTCCGTCTGCACAAAC
ATTTGATCAGTGCCCATTCGTGCTTTACAGCGAAGACTGATGCTGAAGGATGCTGAAGGAAACTGCAGCAAGCAAGAGCTAGAGGAGGATGTGTTCGGCA
AGTATACCATCGACAGCATTCTAAGCGCCAAGCTACTGGAGATGGCGGATTCAGACGGCATTTTCCGGTTCATCTTGACGTCGTCGTCGGGAGGCAAGCA
CGACCACGATCTGCATTGTGGTGCTGCTCCAGCTTCACCCGCTGACGCGCCTTCCACAGAGCTGCAGCTGCAGCTATTGAGCTGGGAAACGATGATCAAG
CGAAAAGACTCCAACAAGTTTAGTCGCGTGCTGAAGGTGCTGTATGCACCTCGTCAACCGATGCCAGCGATTCCGGGTCTATTACCTTCGCAGGAAGTAA
CACTGCCGCCAGCAATGTGCCTGGCCATCGCCCAGCGACTTGAATCCAGCTCTACGTTGCTGCCATCGTCGCTGCGCGCGTTCAACCGGATGCACGTTGG
CTACCTCTTCGCTTG