Transcript Name :
Phyra_g19
Orientation:
(+)
Number of Exons:
2
Description :
hypothetical protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Ubiquitin domain13.01PS50053
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-85
86-108
109-123
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
protein bindingGO:0005515IEA
*** None ***
*** None ***
Sequence
        451 bases(100 bases per row)
ATGCAGCTCTTTATCCGCTCGGTGCGTGGGCAGCAGCGACTTGTTGTGCCCGACGCGAATCCCCTGACAAAATGAAAAACGTCCGTCTGTGACGTTTGCA
GGATGCAGGACGAACGCTCACCGTAGCGGTGGCCGACCCGCGGGCCAAAGTTTGTGAGCTGCTGTCGCTCGTGGAGGCCAAGCAGCAGCAAAGCAGTCGC
TCCGACCAGTACCTGAACTACGGGGGCGTGCCGCTGCGCGCGTCGCGATCGCTCACTGACTACGGCATCCAGAACCACGCGACGCTGGACCTGTCGCGAC
GACTGCGCGGCGGCTGCTTCGGCTTCTCCATCATGTTGTGGATCCTCATCTTCATCTGCTGCTTGGTCAGCGTCTGCACATGCGGCCTGTCACTACCAGT
GGCGCTTTGTCTGCTGCCTCCTGCACTGCTACTGCCGCTCTGCTGTCTTTA