Transcript Name :
Phyra_g11580
Orientation:
(-)
Number of Exons:
7
Description :
KUF77673.1 hypothetical protein AM587_10010976 [Phytophthora nicotianae
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-853
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        12193 bases(100 bases per row)
TGCCAACTACCAAGTACAAGACGTACCCAAGCTAGGTGTGTGCGGCTATCCTGCGAGTGGCAAATAATGCTGGTAACTGGAAAACCGTGGCGGAACTCTA
CACCGTCAACGAGCGTACTGCATGGGGTTAGATCAAGAGGGCCATGGAGACTGGAGACTGGAGTGGTGACCAACACCAACGCGGCAGGTCATCTAAAAAG
CTACTTGTTGTTCACGATTACCTGCTCAGTAAGATCGAAACGACGCCAGAGTTGACGCTAGTCCAGATGGTACAGCTTGTTGAGCAGAAGTTCGATGTGG
TTATCAACCGGGAGACCGTACGGCGCGCTCTAGATGCCCGCAGCTTCACTCTCAAGACGTTGCACTGAGACGTTGTGAACCGCAACAGCTCAATCAACAA
GCAGAAACGCTACGAGTACGTGATCAAGTTTTACGCAGCTCTCGCTAACGACAAGAAGGTATTTTATTTGGATGAAACGAACTTTAACTGGTCGTGCTCA
CGTGGGCGTGGCTGGAGCAAGCGGGGGCAGTGCGCAGTACAGACTGGTGTTTCCAGTAAGGGTAAAAATATTCATATTATTGCCGTTATCTCAAGTACTG
GCCTAGCCTACCAAGAGTCGCAGTTCGGCTCGTTCACTGCTGGACTCGCGAACGAGTTTATCAGACGATTCCTGCGCCGCATCAAGACCTCCACCCTTCT
GGATGAAGTCGTGCTCGTGCTCGACAATGCCCCGTGTCACACCAACATTAAGGATGTGTTCGCCGAGGAGGAATTCCAAGATGCCGAGATGCTCATACTC
CCCTATGCTGAACCCGATAGGGAATGTATTTTCTGTCTACAAGAGTGCTGTGAAACGCTTTCTCGCGCAACAGCGTCCTGGTATCCTGCGCGTCCCCGAC
GGCACAACGATTACGGAGCATCGCGCCGGGTATCTCAAGCTCGCTGCAGACCCCCTGTTTGTCGAACTGGTGACTCCAGCGCGCAATCGAGTGTTTTGCC
ATTCACTGCCTCATCACCAGTGCGCGTTGCACTTTGAGGACATGGAAGTTGGGACGTATTTTTGATAAGATCTGAGAGGTAGTATCATTTTCAAGGGTAA
TACATCTGACAGGTTTTTGATTTTGAGTGTTGACTTTGTAAATAACGCCGTGCTATGGTGTATTAACTGACAGATTAGAACTTAACAGAGAAATCAAACG
CTTGAGATGTCCTTCATTCATTCGATAGGTCCGGTTGCACTTCTTTACACGGCGAAATCTTAGTACGTGTCCGCTCCAAAATACACGTACGTAGAAGATC
TCACTGACATCAAGGTTGACTGAGGGCTCTGCAAAGCAAACAAGAGCGCCCGCCATCATGTCCTCCAAAGCTAAGGTACACCCCATACCTAATTGTTTTC
TAAGATGAGTGCTAGCACATCTTGTTGTGATTGATTTAGCTGAATGTTTTTCAACAACGCGATGGGGATTCTTATCACGTCAAGATATCCGTGCACAACA
CCATGCACAACCATCGAGTTGACAAAGCGCCGTACAAGTGTTTCCGAAAGAATCGTTTGAAACTCCCGAGCGGGATATAACTGCGGTTAACATGCTTCGG
AAGGCTGGCCTCGCCCGGAAAAAAAATCTGCGCTACATCTGGGACAACACCAACTCTGAGCCAGACATGATTGATGTTCATAATTTTCTCACTATGCTAA
AGCGCGAGGAAGACGCGGGGACAACACTGTCAGACCGCGTGTCGGAAACACTCGACCATTTCTGCGAGAACGACCATTTTGCAACAGCACACGTTGATAT
TGACAGAGAGAGAGAGCGAAGGTAAGCAGGTTTTACATTTATTTAGAGGGATGTTAACGTGTTGTTTCATAACAAACTGTTTCTTTGGTTGCGCGTTGTT
GCACGATGTATAACCATTCAGACCTATCACATGCGGTCGTTTTTTTCATCTTTTCCATAGGCACTCTTAGTCGATGCCACGCATGATACGAACGTTTCTC
GGTATAAGTTGTTTTCGTTTATGATACACGACTCTCTCGGGCATGGCCAGCACGTGCAGGTGGGGAGTGATTCTGGAATTCTTGATGTTCTGTGCTTGTA
GAGTGATTGCATGTTGTTAATATTGCTTGCTCGAATGACCAAAGAACCATCTAGTAGTTACATGCGGATGATTTTGTGCAGATTGTGGCATATATTGTGG
TATCTTGTGGCTGCTTGTATAGCTTGTGCCCTGTATGTTGTGTGTGTTATTGGTTTTAGCCTGCTTTGCTCACTGATGAACGCACAGAAACTTTACGACT
GGCAATCCGGCAGTTTGAAAAATACAACCCGCCCTGGCAAGATGTACAATGTGTTGTCGTTGACAAAGACTTCACAGAGATTGCCGTTTCACCAGTGAAC
AACCAGAAGCTTGCGTCCTTCTGTGCCAGTTCCACGCGATTAAGTACATCCAGGATAGGATTGGAAAGACTAAGTACGGGTTGGACGCGGTACAGAGAGC
AAGGCTCAAACCGATCGCGAGCCTGATACTGCGTGCTCGGACAGAAGAGGAGTATCAGAAGTATTTCGTGTATCTAAACCAGGAATTGCGTGTGAAGGAA
GCCGCAGAAGCAGGTGAGGATATGGAGATTCCCGGGTTTTGGAGTTACTTTCTAAGGAATTGGCATGCGTGCAGGACAATGTGGTGTTCATATTTACGCG
ATAACGTAGCACACATTGGCGATTTGACGAATAATCGCTTGGAGTCTTCATGGCAAAAAATCAGGACTATTGTGGATCGAGAAGTGGAGTTGGATGAAAC
AATGACAAGCTTGATTTGGTGTGCTATGTATAAGGAGAGGCTGTTTACGGCCGAGCTATCACGCATCGGACAAGTTATTGATGTCGTACAGTACACAAGT
CCAGAGTTCAGAGTTGACCACGCTCGGTCAAATTGTGAGCAGACACGCTTTTGATATCGTTAAGGAACAATACGATGTAGATCCAAAGATAGCCATATTC
TACACTGTACAAACCGAAATTAACGGAAAATTTGTCCTGTCGAGCGAGAACACGACGTGTACCATGGATTCATCTAACTGGCAGTCGCAGTGCATGCTAG
GGCGAACACGACGACTCAATTGTCGACACATGATGTACTTGAGGAGAGTGCAAAAGTTTGAGACGTTGATTCCGTTTGGGATGATCCCCGATCGGTGGTG
TTACAAATGAGCAACTATGATGCAACATTTTGTGAATAAAGACTTCGACGTGAGTGGATTCTCGAAGAGCACTTTTGTTGCTTCTACTCCCTATCGTTCT
CGTATGAAGACCCAGTCGGAAAGATATCAGGAGGCGTCATCCAGTACCAAGCGCCATGCAGAGACAATTAGCACATATGGAACGGTGCGGTTTCAACGTG
CACTCGAGATCGTAGATTACCTTGCGCGCTCTTTTGCCTGCTGCGACATCGAAGCTATAGAGAGAGTGTGTGCTGCATTCGAAGCGGAACAGGTACCACC
GCTCCTATCTCCACAACACAAGGCACAATCTCCACAACACAAGGCACAATCTCCCCAATCACCACGATATAGGGTACAATCTCTGCAAGCTGAAGAACCC
ACTAGTACTTCTAGCGTTGCCGTCACGGTCCGTCACGAGTCTCACGTAAACTCGTCTCGTACAATAAAGCTTCTGGAAGACAGTGACAGCGATGTGGATG
ATTCAACAGCCAATACACACAAACACGAAGCGACAAGGAGGCCGCGCATATGGTCGATGAGTGGAACTGTGAAACCACCCGGCAGGTCTACGCGCACTTT
GCAGCAGCGGAAGTTTGAAAGAAGAAAGAAGTTTCAGGAGGTAACAGCCCTTCTTCGGGAAGCTAAGCCATCTTGCGGTGAAAACGCTGGTCTATCTGAA
CTGCAACGCCGTTTCAACGACGAGCCTGTAACCTACCAACGTTTCCGCCAGTATCTGGATAAATTATCGGTGCTATCCAACATTCCATTGGTGGATGATA
TCCCAAATCTGTGTGTAGCTGTCCCTTCGACAAAGGAGATAGCGGTTAAGAAAACTATGGACGTGTGTATTGTTACCCTTCCCCAGATTGGGTGGAGAAT
TGCATGGATCTAATGCAACGATACAGAAACGATTACCGCGATCTAAAACAAACCGTACTGGAGGATGAACAAATTTTACTGAAGTTACAGGGTGGCCGCA
ACTCTCTTTACTCAAACGTTACCGGGGATTTTATCTACACGATGGGTGCGTGGCATGGCGCCACAACTACGTTCGATAGGATAGAGGCGTGTGTCGACTG
GATCCGAGAAATTGATGTGAAGGAGGCCCAACTGGGGTTACTATTTGGAGGCGAAACTCCTGTAGATACCGAGGATGGATGCACATGCGTGACAAATATT
GACATCAAAGATGACGAGAAGAGGGCGTTGCTCGATCTAGTTCAGGGTGAAGCGCAGGACGTTCTCATGACCGCAGTAATACCTGCAATTTGTACAGATG
CCAACAGTCGCTCGCAAGTACAACTCGCTACCACGTTTACAACGCAGCTCATGGGATCAGTAGAGATGTGGAGAGAGTAGCATGGCTCACAGAAAACAAG
GTTGTAGGCACGACAGAAGACACAATTGTTGGAGCTCTATGGACGAACCAGAACCACTGGTGCGGCTTTGCTATCAGTAAAAAATACGTATGTCTTTACA
TTGACGGATCCGGGAAATGACAAAGATACTATCGACACTGTCGAGGGCATTTTCAGGCAACTCTCCATTCCACTCTTGCCCCAAGAAAAACGCTGGAAGC
GAGATGTGATCAGATTTTATCAGCAGATCGACGGAAACAGCTGCGGTGTACTCGTTTTAGCTTTCAGGGAGAGTTATCTTTTCGATTCTGCAGATAATCC
GGCCAAAGTGAATTTGCTGCGGTTTTGTTATCTGCTGAAGGTACTACTAGATTAGTCTATAGCATCATTACCTCCTCAATTAATTCCTTCCTGTCGAACC
TGGTCTTCTTGTACGCAACGTCACCTGCTGGAGCACCGTTGATATTAGTAAATAAACCTTAAACGAGCAATAAAAGAATGCTGTCAGCACTATTCATAAA
TGCGCCACCGCTGTGACAGGTACGTGCTCTGCGTTGTTTCGGCCTGACAGCGTTCCTCGGCGGTGTCGATGATTGTCGGTGAACTTGATGTCGTAATGGC
CACTGCGTGGCGTCGGAAGTGTGTGTATGCCGAACACAAAATAACGCTTAAACAACGCTGGCGTTGCTTTTGAAGCCTGCAGGATCACAGCTGGGATGGG
GAGTGCAAAGTGCTTGTCAGCTTGTGTATCTTGTGCACAACATCTCGTGGCGTCTGGTGATGATTAATGATATTGTGCCACATCATCCCACAATATCACT
GCAAATCGTCGTTGCATCATTCTCTGCCGACAAGATTTGAAAACTACATCAAATCCCTGAAAAACACTATGGCACCAGACGAACAAAAAAGAGTGTGATT
TTGCTACAACATCGCAAAGACAAACACAAGGGACCTCCAAGTGACCACACGAACTTGTGAGGAACCACAAACGAACGTCGAGTGAGCATCACATACGCAA
TACTAGCCAATCCGTGATCGATAACTAACCATTATTGGCAAATCAGAATTCGCTTTAGGGGTCGATCAACAGGCAGTGCTTGCTCGAGTGCCTGCCGCCA
GTCACTTTGAAACGAAGCCCCCATCCCCCATCCCCCCCCCCCCCCCCCCCCCTACTCTCAGAATGCCAAGTCCTCGCCCCTGGGCTCAGATTTTCGCACG
AGGACGCTGCAAGACATGAAAAAGTGGAAGACTGTGAAGAGCCAACTCATGCCGTGCACTTCTTGCAGCAGCAGCGCTCCGCACTCGATGCGCTATAAGC
TGCTGCGCTGCGCCTGCAAGCACTGCAAGGACGCCCCCCCTACATACAATGCCCATGGCGATTGAAGGTGTTGGTGTACCAAGGAACCGATACGATTGAC
ATCTACGAGCTCGACCAGCATCTTTTGCAAGCCAGAACTACATCAAAGCGTGGTCTCACGCCGCTGTAGCGTGCTTTCATCAAAAAGCTCGTGCGTGAGA
ATCTCATGCCTCAGCGTATTCTGCACGCTCTGGGGCGCAAGTTCAATCTCCGGCCCGCTGCGTTACCATCCCTGCGAACGGTGCAAAACGTTGTGCATCA
CTACCGCCGTACCTGTCTGGGGGGGGGGGGGACAAGCACCTGGCGATCATAGAGACCGTCCGTCGTCTCGCACTTAGTGGACGTGAAGGTGAGCATGACG
CCTTCACGTTCACTAGCGATTATGACAAGGCTGGGTTGCCCGAGGTGGGAAATGGATCGGACGCTCGCCCGTTCTTGGTGGGCATGACAACCAAGACACT
CATCGGCAATGCCTGTGACCCGGGTACTTCTGTGCCGCATCTGGATGCAACATTCAAGCTGAATGCAGTCGGCTACCCGGTTCTCATGTGCAGCATTACC
GATGCTGCGCGAACATTCCATCTTGTGGCTATATTCATCACGTCGCAGCTGCAGGAAGTCTATTTTGCTGCAGCGCTAGTAGCGCTGCGACTCATGTATG
CACGCGTGAACGGCGCTGAGATGATCGTGAAGTATGTCCTCGGGGATGCTGACAAGGTGCAGCGCAACGCCTTTGTTAAAGGTTTTGGTGCTGACTGTGA
CTTTGACCACCTTATGTGCTTCTACCACGTTGTTGCTAAGCTACGTGAGAAGTCACGGGGCCTCAATGGAGAGCTCTCGGCGTTAGTTTTTTAGGGGGCC
CTACGATCTCCAGTGAGGCCGAATACGAAGATCGAAAGGCTCAAGACGTGGGCTGCGCACACGGACTTGTTGTCCTTTAGCACCTACGTGCAAGCGCAAT
GGTTGCAAGGCCACTTCGCGAAGTGGCAGTGCTATCACACGCCGACGGGATTTGCCACAACCAACAACCCCGTCGAGCAGTTCAATAGGGCACTTAAGCG
CCACTACACGCACCACCGGTAGTTCAATATGGGGCTGCTGCTCGTTCAGCTGCTTCAACCAATCCATGGCTCTGCAGAAATTCTCACAGAAGCCGACGTG
CCCTGTAACGGTACGGACGCGCACGACTGGCCTCCGATGCCGAGGTTTACTACAGGAAAACGTCGTGACACGCAGCAGCATTGACTTCATTCTCGGGGAC
GCTGACCCAAAGCTCGTGCATGTCCGAGCTGTCGCTCCTCCCCGGTCCTTCATTCCTGAGCTGAACCGCGCGCGCGAAGTGATGGAAACATCGGCCCAGT
TTAGGGCGCAGTGGAGATTGAAGGCCAGCCGCGCACGGGCTGACTTGTCAATCTCCGCACCGTGTACTGCCCGTGCCGCTACTACCTGAAGATGGGGTAT
CCATCAACTGGTCAGTGAGGAATTAAAAAAAAATCAACCTGCTTGGCCGAATCGTCACTCGGTCATGATTGGCTCAGAAATGGTGCGAAAAGCCTAATAT
TAAGATTATTCTCCTGTGATTGGCCATCAATTAGTAAACTACGTTAAGCCATGATTTATCTAATGAGGATAGGGTACAATTACAATATTTTACATGAATT
ATCGTTATTACGAAAGATAAATACCCCTCTTGACCGGTTAAACAAGGCTTAAATCGGAGTCGTCAAATCGTATTGCCGTTGCATGAACAAGAGTGCGCCC
TTCCACTTGGCAAGTTAATAATCGTCACTCACTTTTACATCCGAAACACAGACTCATCAACGTTAATAGAATTGTGGCGCGCAGAGGCTCGATACAACAC
GAAGTTTACAGGTTTAAAATGCCTCGTTGTCTTGTGCGTTTAGCAACAGTCTTCGCAGCTCTGTTCGCACTCCCCACACATGCAACTTCCAACGACGTCT
TCACGCCACTTCCGCAGGATCCCGAGCACCAGAACGCTACTAGGACAGCCTGGCCATCTCTTCGATTCCTCTTCGCACTCAAGCGCAGCTCCATGAAGGT
CTACGGCCAGTCCCAGTTCTCCATGCTGGCCACGTCGGTCGTGTCTATTGGTGGCACCAACGTACTGTACAATGTTTTCGCACAGTTCGAAGACTACGCA
GGGCACTACAACTACACGGAGGTGGGTGGCACCGCGTACCTATCGACGAGAGCAGTTGACAACAACTCCCTCACTCCCTCGGTGCAGTGCACGGACTCAC
ACTCTGGAAAGATCCCGTCGATCAACTCAATTGTTTCGGCAATTAACGCAGCTACAATTGTTTCAAGCGTGTCAGGAAGTGCTGGTGCTGTTTTCAAATG
TTCAAGTGGTAACGTGTTCGAGGTTTCGCTGAATGGAATTAAGTTTGCGTTGTGTGCATCGAGCCCATCGGGGTTCACGATGTATGGCAATGATATGGAT
ATCGCCGTCGAGTACCTGGAAGCTCATGTGGATATTAGAGAACCAGCGGCGGACGCTGACACTATCAGGAGATGCAGGACGACATCATTTCCGAGCTCTC
TTACGGGAATTGGTCAGTCAGTACTTACTGGGCGACCGATCCATCTAGTTGATTCGCGGAAGTTGGAAGCGGCGTTTGATTTCTCGCTGGGTGATTCGTG
CTCGTGCAAGTCAAAACCTCGTCCGTGTGTCTTCATTCACGGCTTGGGAGTCAAGAAGGAACTCCCAAGAAATCGAGATCGGTTTTACTACTGGGGCGAC
TTGGAAGGCCATGCGCCGTGCTGTACGTCGATAAAATACACATACCTCAACACGTCGGGCAATCCGTGGACGAGCAACGTTCTGCAGCAGAAAGTATGCG
ATCGGGCGATGGCGGTGAGTGATACCAGCACAAATTCCTCCATTCGTGACACTATCGTAGTGGCGCACTCAATGGGGAACTTGATGTTGGCCGGTGCGCT
CGCTAGTGGAAAATGCAGCTTGGATTCGAGTTCAACGTGGGTTGGCCTGGCAGGTCCGATGAAGGGAAGTATGTGCTCGGATTTCATCCAGGATTCGTGT
GCTGGTGAGACGACTGCATTCTTGGAGAATGTTGCCGAGGTTACTGGAAAATGTCCCCCCACGACTGGACTGAAGTCTCTCCCTTACCAAGATCACAACC
ATAGTTCTGCAGCACTTGATAAGGCTTACGATGCAGCCCAGAAGGCTTATCGAGAGAATGTGTATGCTGTCATGTGCAGTGAAGGTTTCTCCGGGCTTTT
GTCAGTGTACCAATCGATATTTTGGATGCTAGGCAAGACCGTCCCTCACAAGTCAAAACGGAACGATGGAATGGTGGAGTTTGCTAGCTGCGCAGGTGGC
TTTCCAGAATCCAAGTTTGGCAGCAGCTATCACGATCGCTTTTACCGAACGAAACTTAATCACTTCGACATGGAGTTCGTAAGTGGAGATGCACTGCTAG
ACGAATCGAAGATGCCCGTCAAGTGGTTCGAATGTCTGTTGTAATTATTAGAGCAGAGTGGAAACCTTTCGGCAAACGCGTAGGATTCATTGCTGAGCCG
TCATAAATTGGTGCAGTTCCTCGGCTATTCAATTGGCAATTTTAACACTCAAGGCCAGGGTCTATGATAGCGGCCGCTTCGTGCTACAGTTTAAGCGTTA
TCTCGGCACTAGCTCGTGGTAGGGAGACTTCAAGATTCTTAAGCTCAACAATATCTTGGCTGTCCCACGGTGAGAACCTCAAGTCTTTGGATCGAACCCA
GGACGGCTTGCTAGAAGAAAACTATTTTGTAAATGTAGTGCGTGTAGATGCCGGCTGCGTCAGGAGGTTGTTGTAGCACGAAGAGATAATAAAAATCTGT
ATTCGGTCCCCTCGCGGGGACATCTCCACGAAGCTCAAACTCATGGGTCAACACATTGTACCTATATACTTCGTAAACACGCTTGGGCTTGGAAAGTGCC
TCCGCATCATTACCGTATTATATACATAGGATAGGATACTGCATGCCAAACAATGAAAGTAGTACAGTACCTACATGTACGCGCACACCCATCAGCTCGT
GATTGAAGACAAATTTTAGCGCAAAGGACCTGGCGAGGTGGGAAAAAGTTTTACTTACATCAATCATCGGCCTCGTATTTTACATGGGCACGTAATAGAG
CGTGGCTACCCTTGTTTCTGTCTGTTTCAGAGTGGTGCATTAGGAAATCGCACATCGCGGTGCAACTAGCACTGCAAGCGGCACTTTGTGCAGGGCATAT
GCGTGCATCAAGCAATACAGTATAATACTTCAGTAATATACACGTACAGCACCAGCCAACGCGACCACCTCAAGCGATTCACACGTTGAACAGATGCAAG
GAGGGAATTGAACGTCGTCACCAAGAAGTCGATTCAAAAATTTCCTTTGATCGACAGAATATCAACACTTTGCTCTTCGCTTCGCTCAGCGCTTATGGCT
GCGTGCACTTCAGGCTCCTTAGCGATTGTGATGATACCAAGAAAAGCTTGGAGGATTGTGCGAATCGTGCAGCAAAACAGCAGGTGTCGGACAGTGCGAA
GTGTGTCTGATCGAACGACAGGTTTCCCAGCCCATTTCGTTTTCTTCTGCACGTACCAACCTCGTTAGCCGTCGCAGCAACTTCAGAAATGGCGGCATCA
CGGCTAAGCTTCTTGGTGGCAATTGCAGCAAGTATCGCGTTTGCGGCTGCGATTCCGCGGCAGGAACGACTTCTCCAGAACAAAGGGGCCACACTGGAAT
GGCCTGCATTGCGACTCCACATTACCATCAAGCAAGACTCCATGAAGGTTAACGGTCAGGCTGATTTCGACATGTACGCCAACGCCAACGTCTTGGAAGG
CAACCAAAAGGTGCTCTACGATGTGTACGCGACTTTCACGGAAGCCAAGACCCTATACAACTACACACTCGTGGACGGTGTCGGGTACTCTGAAGGTACC
CCGTACACAACCAGCAGCTCTTCGGGTGTCCCGACGCCGCACGTAAAGTGTCTGGACACCGAATCAGGCAAACTCCCGGCGATCAACTCCATCGTCGCTG
CCATCAACAAAGCCACCAACAGCAGTGCGAATAGCACTGATCCTAATACTCAGTGCTGGACTGGGAACCTGTACAAGACAGTGATGAATGGCGTTGACTA
CACAGTGTGCGGCTCGGACGTGGGTTTTACCATGCAGAGCAAGGATATGGACATTTCGGCGTATTATTTGGAGAGTCAAATCGCCATTGTGGCCCCGACA
GTCGACCCCAAGGACAAATGCCAAGCGAAGGCTTCGGCCAGCTCAGTCTCTCCAATCGGACACTCTGTGCTCACGGGAGAGCCGATTTCGTCTAAAAGAA
TGCTGAGCGCGGACTTTCAGATTTCGCTGGGGGATAGCCCAACGTGCTCTTGCAAGTCTACGCCGCGTCCGTGTATTTTCATCCACGGCCAGGGACTCAC
ACCTGAGATGCCGGAAAACCAGGACTCGTTCCCGAAATATTGGGGAAATCTGACAGACCACGCGCCATGCTGCTCGTCCATGAAATACGCGCGGCTCGAA
ACCATCAACAACGGCTGGACGGACGAAGTCCTACAGCAGCAAGTCTGCGACCGCGCACTTGCAGTGAGCGATTCCAGCACCAAGACCACAATTGCGGATA
CCATCGTAGTCACCCACTCGATGGGCAACCTGATGCTGGCTGGTGCCATTGCCAACGGGAAGTGCAAGCTCGACTCCAGCACGACTTGGGTTGGGTTGGC
GGGGCCTATGAAAGGAAGCATGGGCTCAGATTTCACTCAGTCTTCTTGCGCTGGCGAAACGAATACCATCGCGGAGAAGTACGGGGATATCACTGGCAAA
TGTCCGGTCAAGGAGGCGGTGGTTTCGTTAGCGTATGAGGGTGAAAGCTACTGCTCCACGGAGCTTGACGCCGCCTACAAGGCTGCACAGGAGGTGTACA
TGGCGAACGTGGACGCTCTGATGTGTGGCGAAGGGTATTCGGGGCTCCTCTCAAGCTACCAAGCGCAGTTCTGGATGCTAGGAGTTATCGTTCCTCACAA
GTCCAAGAAGAACGACGGCATGGTGGAGTTCGACAGTTGTGCGGTTGACTTCCCCTACTCCGACTTCGGCAACACCTGGCATGATCGTTTTTACAGAACC
AAGCTCAACCATTTCGATATGCAGTTCCTGGCGGGCGATTCACTTCTAGATATGGCCAAGATGCCTGTGAAGTGGTTTGAATGTCTGCTATAA