Transcript Name :
Albla_Nc14000110
Orientation:
(+)
Number of Exons:
4
Description :
mediator of RNA polymerase II transcription subunit putative
This protein is Not Signal Peptide
This protein does Not have transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        683 bases(100 bases per row)
ATGCAACGCCTTAGTACTGATCAATTAAAAAACATGCGTGGAATTGAATATGAAGTAGTACCGAATACTGCAAAACAACTTCCGCAGCAGATTTTTGGGA
TCCGGAAGCAGCGAAGGGAAGGTCGAACACAGGTCAAGCTGATGGCGATATATTATGTGCTGGAAGGAACGGTGTACCAAGCACCAAACGTTCACGCAAT
GTTGAGCTCTCGATTGGTTAGTTTCATCCGTTGCTGAGATCATGCTGAATTATTTCTTAGAGAACGTGTAGTTTCCGTGTCGGAAAAGCATTTCGAATGC
TCAACAAAGGAGTTCGTTTCAGCCCGTCGGAAGGTTATTCTTGGGATTTCAGTACTCTGGAGAAAAAAGCTCCCGTAATTCCGTCTGAGTGTAAGTGTAT
TTTAATTGTTTCTGAAACTTCCAGCCGACGTTATTTTGAAAGTGTTACAATTAAAATTGAAGCAAACGCATGAAAAAATGGAACGGAAAAAAGAGCAGAG
CACACGTGTCGACGCAATCATCGTGCAGCTCATGAAAAAGGTATGTAGGGAACAGCTTCACGCACTCGAAATTTCGTTATCTCGTACTCGGTTTAGTACG
CCCCCGAAATGATCGGCAAAGTTGAATTCAAGGACGAGCCACATCCGGAAATGCAGATTAAGGACCAAATGAAAACGCAATAG