Transcript Name :
Phyra_g5846
Orientation:
(+)
Number of Exons:
6
Description :
hypothetical protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-404
NN-scoreoddsWeighted Score
0.6624.8860.01
*** None ***
TypeScore
nuclear43.5
GO
*** None ***
*** None ***
*** None ***
Sequence
        6092 bases(100 bases per row)
ATGAGCCTGAACGACTTGAAGCCCCCAAACACCAAGCGCGCGCGCGCGACGGCCATAAAGGCGTTCAATCGCTTCCTCCCCGCCGAAAGCACGAGCATGA
AGCATGTCAAGGCTTTGATCGTTGCCGACCCAAGCCGCGCGGGGGGCATTCTAGTGACTCTGATGGACAAGTTTGGTGTGTACCTGGCATCCCATGCAGG
AGCAAGGGGGCTGCCCTTGTCGCGCCATCCCGTCGCTCAATACTTCCGCCAAGCGAAGTGCTGGCTCTTTGTCGAGTACCCTGTTCAAGGTGGAGCTGTG
GCCCGGCAGCTGTTCAGCTTGGGGCGTGCCCTTGAACAGCACTGCATCAAACGCGAGAGTGGTGGGTTCGTCAAGAAAGCGGTTGCATGCACGAAGGATG
ATCTCAAGAAGATGACAACCTAGCTGTATTCAACGACCTGTTGTGCATCGGACTACCAAGATACATCACTGTTGTGTCTCTAGTGGTATCTCTTCGGGCG
CGCTTCGGACCTGACCTTCGTCCGGTAGCAGCAGCTCACCATCGGTGCTGGTGGCGTGTTCTTTATCCGCTTCATCCGCGTGAAGACGTCAGACGAGCAG
ACGCTGTCGCTCTTTCCCGACGAAGACTTCATGACTTGCTCGCTGCTGGCGCTCGCTCTGGCCTTGATCACGCAGGAGTAGCCGTGCGCAGCGCTGCTCA
ATAACTTGCCATCGCAGACGAAGGACGTCCCTGTTGAGCTGACCGACTCGATCCCATTGCCGGACCTGCTTGAAGACAGCGGCGCCCTAGATTCTTCTCA
GACGTCGAAGAGAAGCACCGCCGTCCACACGACACCGACCGTCGGAGTCCACGCTCTTGTCAACCGCTTGCTCGATCGTATTGTTGGCCCAGCTGGCGTC
GAAGAGCCGCTGACCTCTCATTCGTTCCGACGTGGCGGTGCGCAGCATGCGAACGCGAGGTCAGAGTTGACGGCGCAGTGGATATTCGACCGCGGAGCCT
GGAACTTGACCACGACTAACAAAGCCTTCGCATACGTCTTCAATACTCCAAAAGAAGATCATCAAGTAGCCAAGGTGCTGAGCGGGATGGCACCAAAGCA
AGTCTCTGTTTTTCCGTCGCTTGATGTCTTCGACTCGGCTACACAAGAGGATATTTGAGAGGTTAGCCGCAAGATCTTCAATGCAAGTCATGCGCTGGGT
AACAAGGCCTTCAATGTCTGCGCCGCTGTAAGAGATGTGCTGACAGCAACTATCTTCCTCCACTATCCGTCGTTGATGAAGACCAACGCGCAGGCGCCCG
CAATGAAGACGATCCAGCGCTGTGCTGTAGCTTCTGGTGTGACGACGACGAGCCTGCTTGCCTGGTCACAGCAACTCACGAGGTCAAAAGCTCAAGCCAA
CACCACCGCAGAAGACCTGATGGAAGGAAGCGTGAAAGTTGAGTTCGATCATCAGACTGCTTTGATTGAAAGGTTAATTGAGGTCAACCGTAGCCTCGAG
GCTCGAGTCAACTCGCTAGAAGCTGCAAGCACCAAAACTGAAGCAAAAACATCAGCACATTATGGTCAAGCCAAGTGACCAAGAGATGTAGATGAAAGCG
TACCTGTGAAGCGCCGACGCTGCTCGAAGACGATACCACTTATAGACACCTTGTTCGTATGGTACACTGCCGTTCCGCGCGGATGGCTAAGCACGAACAA
GCTCAAGAAATCAGACGCCAAGCAGCTTGTTGCCTTCATGAAGCTCTTCATTGAAGACGGATACACGCTCGACGAGTCATCGCCCAGCTACAAGGATAAC
GTCCGCCATCTCGGAGAGTTAGCGTCACGCAAAGTCACTGCGTACCTAGACGCGCGAGGCGTACTGTCAAAGGGACCCAACGCTGTACTCAAGGCGCTTC
GGCAGCTGCATCGCGAGGGAAGCCTCAACGAACTCATCAACGCCTATCACCAGCGTCTTGCCAGCGACAGAATTGTAGCCCATGCACCTATCCATCAACC
AGGCACACTCAAGCTGCTCCCGTAACGCAATACGATCCCCTTTCCCGCGTCCTTGTAGTTGGTGCTTGCATTGATGTTAGTCATTCGAGCATAGAAAATT
TACCGATGGGTGGAATCGAACCACCTTCTTCCCTTTCGGGGGCTCTTCCATTGAGCTACATCGGTGGGGGGTTAGCCAACAACATCGCTGAGGTACTCGT
CTGGAGTGCTCAACGGGGAATTAACGGTGATCCACAGTTCTTCGTGGTCGCGACAACCCTCTAAGGTAACCAATGCTCGGTATCCCCCCCCCCCCCTCAA
TTCACCGCGCCGGGTGGTCAATCGAGCACTGAGCTCGCATGGCAAAATGGCGCAGCAAAATTGCACGCACGCCACTCATTTACGAGGCGTAATTACGTCT
GCCACCTATTAATGAGCCAATCATTTGAGAGGGTGTAATTTTACGAAACCTCCACAACCTGGTGCGATATAAAGTTTTGCGATAGTCGGATGCCGAAGTT
GTACTAACGGTCGGAGTCGTGACGATATGGATGTTATCGAATTTTTTTTATGCGGAAACAGATCACAGAACCACTCGTACCAGACCGAGGCAAGCTATTT
GAGCTTGGTCGCGTCCGGGCTAGGGTTGGGAGAGGATTGCCCGGTGTAGACTCCGGCACCTTAAAGGCCGCGCTCTCTGTTGCTGAACCGCTTTCGATTG
CGTGTTCTCGAGATGCTGGAGGTGTTCACCCAGTGACTCCACCTCGCCGACCAAGTTGTTGACGAGCAGAGTTTGCTGCTCGATGAGGACTGCCTATTCA
CGCATGAGCTCCTCCGAGGTTAAATTATTCGGTTCCGAGTAGGACGGCTTTGGTTCCAAGCCGGATGGACCCTCCTTCAGCGACATATGAATGGTAAGTT
GCCACACATCCATCTCCGTTTCGCTTATCTGCTGCTGAACTAATGTTTGTCGCACGCGTTTGATGTAGGGTACGCCGGGAGCAATTCGCAGCACGTCGTG
GTAGTGTAGCAACACAACGGCTGGCAGCATCTTGACCACGTCGTCTTTGTAAACTGAGGGCGTCAGAAAATCCTTGTGCAGCTGCGAAGAGATGAGCTTG
GAACAAACTAATTCTCTCCAACACCACAGCGTCGGAGAGAAGGTAGGCATGCTTGCGCTTCTATATCTCACCCAGCCAACATTTTGCCAACCATTTGCCC
TTCGTGTGTTGTGCTTACGATATCGTTGAAAGCCTTACTTACTACCGTCGTACGCTAGCCCCCCTGTCAACAATCCATGGTGTGCTGATGTCGCTGTCGC
CGTTAGTATTTTGGGCTGCACCTAGCCGAAACGAATGGGAAGCCAACCTCTTCGTCAGACTGCCGCCGTCTTTTACGCAGACAACACTCCATTTTTGAAA
CACACGGTTTACATAGGCATGAATGCCCGGGATAACAACGTCTTTACTTCTGGGGGCTTCGTCTTGGCTGCAAGGTTCTGCGCCGTACGGAGCGTCGGCT
CCAGTCTCGAGAAGGTCGCGAAGAGGTGTCGATTGCTGGGAAATTGAGAGGTCCTGATGTGTGTCTCGGGGGAGTTGGTTCAACAAGAACTCACTTGATG
CTCATTGCAAGATTGTAGCTACAGCCAGTACATGAATATCACACGATGAAAAGTCGTTGGGGTCATGAAATAGCGATGCGCCCTGACTCTGAACAGAATT
CAACCAATTAAAGTTGATGAACAAGCAACCGCCTGGATTAGCGTATATAATTGACAATGAGTATTAGATAGTTCGGGTATCATACATACCAGGATATACC
GCGACCTGTTTTTTTATTAAACACATCGTGTTTGACGACCGACCGAATAAATACCATAGAAGGTTGAGAAGCGCGGCGTCCTTGTAGTCATATGGAGAAG
AGTCCTACTTGAATATAGTAGTACTACGTGTGCGTAGGTCGCTCTTCGCACATGGTGGCGCTTGGTGCGTGAAATTGGTGCCACCCTTAAAGCAGTACTT
GTCGATAATCGACGCAATTTTCTGTAGACGCTGACCGGATTCAGCATTTAGGAGCAGAAACATCTCTAAAAGGTGGCTGTTGACGTTGCCAAAATAGCTA
GCGACTAAGTTCTTAGACCTTCGAGCTTTCTTTGTAAGCTAAGCACACAGCTAATTTGTCAAGTATAACATAAATCATACCCCTGTACGTGTCACTACCT
ACGTGCTCACACACTTCCTTCACGGTAAGCTGTTCAGACATCGCAATGCTCTCGAACACTGAGATCCGTCAAACGTGCCCTTTGGGAGTTCCCGGGGATC
AACGCTTTCGTCGGCATTAGCAGTTTCTTCGAGTGGCTGTGATGCCGTCTCGTCGGTTAAACCCTCTCTAATCTGTTTTTTGTCCGAATATCAACTATAT
GTGTCGAATGTTTAAGATGATCGTGCTTAGACCCACTACTTAAGCTTACACGTGTGCGCACGTGTATGAGGAAGCGTAGGAGTATTTAACTTAAGTTCAG
TATACTTGTATCCGCAAGTATACTTAAACGAAGACAAAGGGACCGAACGATAGCTTTGGTGCTAAATGAGAACTGTATTGATTGTAAATGGGGTTTCCTC
CTAAAACTGATATTTCTAATGAGAGGTTCTGCCATTGGATGGCTGGCAGAACCCCTATCTATTGAATGACTCTCATTGGTAGAAAGATGTTACTTTCTAC
CAGTCATGTGCCTTTTGCTATGAATGTGGACCACCCTGTGGAGTGGTCACCTGAATATATCCCTTAGTGCATGTTGCACTAAGGTAGGAGGTGTACCGAA
TGTGTAGCCCCGCTACACCATCCCCCCGTTAGGATTTGACGTGCCGGTCTCGACACGTCAATCCGTAGTTTCTTTGGGAGAACACGTGCTCATTCCCAAT
GAGCACGTCAACGACGTCATCGTCTAAGACGCCGGCCGCTTCGGCAACAGCAAGTGCTGTCGTCGCCTCCAAGGCGACGACGGCCGCTGCCTCAGCCACG
ACCGCTACTGACATCGCCTCGACGGCGATGCCGACAAGCGCGGCAACAGAGAGTCGCCTCTCTGTTGCTGGATACCACTCGAGATGGCATGAGAAACATG
CCATCCGAAACAAGACAGGCAAGATCATTGCTGTCGAAACCGGAGTGGGCATCTACTCTCCGGGTGGAGAGGGAGTTCCCCTCGACTACGGAAGCGAAGT
CGAGGAGGGGGAACTCGAAGGAGACAAGGACCTTGTCTCCGGGCCACACTGACCCCAATGTGGGTCTGCGTCGTCCACGCGAGGACGACCGAACGCTTCG
AGCTCGAAGCGTTCGCGCAGCGGCAGTGGAACACCGCTCGCTGCCGCTGGAGCCTTGACGACTCCGCGGGATGGAGATGACTCGCTCCATCCGCTGTTGT
TGCGGCCTCGCGCACTGAGCCAGTGCGCGAGCCGTGGATGCCGTCTCAGTCTGAGATCGGCAGCCGATTCGGTGCGACCGCGCCACCGAATCTGTACGCG
CTGTATTCGTGCAACGCCATCGTTGACGATGACGTCGCGAAGCGAGTACACTTTGATCCGTTAACGAATCAAAGGCGCGACTACTACATCGGGCTCTTCC
ATGAGCTCCGATGGTTTGCGAGCAAGAAGACTTCTCGCAGAAGCAAAGTGCCCGAGTGGCAGGCACTTTGTCAAAGTTGGAGTGCCTTTGTTGAAAACTT
CAACAAGAACCCCGCTGGCTATCGCGACCGGATTAGCCAGGCGCGGGAGCGCTACGAGAAGTTCTCGAAGCGTGGTAAACTTGAACGACTGCACCATGGT
GCAGTCGGTATTGGACTTCCTTGCGCAGTGCCTTATGACACTGCTTGTGAGTACTGCTACCCGGAGCAGTACGCATCACCGAGCGGGACGTCAACGGGTA
CACGTCCATGTGTGTACCTGACGACCTCAAGACCCTGCGCGCCAGTTTTCAGGCGCAGGCGTCTTCTAGTGCTGCGGATATCGCAGCACTTACAGCGCTC
GCCCAAGTTTTACGCCCTTCGGCGGAGGTGGCGGTGGCGGCCTTCGTACGCCGTCACCATTTCCGGAATGTCCTCCATCAGGACATTCCGTG