Transcript Name :
Phyra_g4142
Orientation:
(-)
Number of Exons:
3
Description :
RAW24142.1 hypothetical protein PC110_g19429, partial [Phytophthora cactorum
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Zinc finger, CCHC-type9.801PS50158
Integrase, catalytic core24.279PS50994
HmmSmart predictionP-Valprediction_id
Zinc finger, CCHC-type0.00057SM00343
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-1014
*** None ***
PositionContextScore
220DNKRKGR|PV0.559
344TVGRFTK|DV0.523
*** None ***
GO
Biological ProcessGO IDPrediction Method
nucleic acid bindingGO:0003676IEA
zinc ion bindingGO:0008270IEA
DNA integrationGO:0015074IEA
*** None ***
*** None ***
Sequence
        3165 bases(100 bases per row)
TGAGCCCAAGCCCCGTCTTCCCTGCCCAAGACCAAGACCCCGACTACGCCTTCGCCATGGACGCCACCCCGACCACGACCGCCCGCATCAACAAGTTCAA
CGGAACCAACTTCCACACGTGGAAGTTCAAGATGCAGATGGTGCTCGAGGAGCGCGAACTGTGGGAAGTGACGAGTGGGGAAGTGAAGCTGGAGCACTGC
ACGACCACGGCGGATCAAGCGACGTTCAAGAGGAAGTCGCGTAAGGCGCTGGCGATCATCTGTCTCGCGATGGAGGACTCGCAGCTACCGCTGGTTCGCT
CGGCCAAGGACGCGCATGATGCATGGTCAAGACTGGAAGGACACTTCGAGAAGAAGAGTTTGGCCAACAAGCTCTTTCTTCGTCGGCGTTTCTTCACGAC
GATGATGACGAAGGTGATGATGTGCTGGAGCACATCAACAAGCTCAAGACGCTGGCGGAGCAGCTCGACGCGGTTGGCGCTCCGGTCAGCGAGGACGACT
TGGTGATCACGCTTCTGGGCAGTCTGAGCGAGTCGTACCAGTTCCTGATCACGGCGTTGGAGTCGAGAGCCGACTCGCTGTCGTGGGAACTCGTGACGTC
TCGGCTGCTGCATGAGGACATGAAGCGCAAGGAACAAGGTGGCGGCGGCGTCGACGGAGCCGCGCACGGCCAAGGTCAAGCGTTCATGACGAGAGACAAC
AAACGCAAGGGCCGACCGGTGAAGAAGACCGGGGCGTGCCACAACTGCGGCAAACAAGGACATTGGATCGCGGAGTGTCCCTCGCGAGTCCAGAACGACG
CTGAGCGATATCGGTCGCAGCGTGCGAACGTCGCGCAGGACGAAGAAGATCCTGGCGACTACCTTTTCTCGGTTGGTCGTACGAGCAGTACCGCCAAGCC
GAGTGACATGTGCTGGTCGACTCGGGTGCGACGCAGCACATGACGAGTTCCAAGACGTACATGAGGAACTACAAGACGATGGCTCCGGTGGACGTGCATC
TCGCGGACGACGGTGTGGTTCAGGCGGTGGGGACCGGCGACATTGTCATGTCGATGAAGACGCCGCGCGGCATGAAGAAGGGGGTGCTCACGAATGTGTG
GCATATCCCGAAGCTGTCGCGCAACCTGTTTACGGTCGGCCGCTTCACCAAGGACGTCGGGCCAGTGACCTTCGAGAGCGACGGGTGCTTCGCGGACAAC
AAGGGTCTCAAGTGGCAGCTCGGCGCTCGTGAGGGCAAAGGGCTGTTCAAGCTGTGCATGACTCCGATGATGCCTGACGAGGCCAATGCGGCAAGTTCGA
AGGATCGCCAAGGGGACACCACGTCGTACCTCTGGCACCTCCGACTTGGTCACATTGGCCATGGCGGTCTAGACGCCATCGTCAAGAAGAGCTACGGTGT
TGGCATCGACATGACGTCGGTGAAGCAGTGGGAGCTGTGCGACGGGTGTGCACTCGGCAAGCAAACGCGAGTGAGCTACATGAAGTCGTCCCCGAACCGT
GCGAAGCAAGTGCTGGAGGTGGTTCACAGCGATGTGTGCGGCCCCATGCAGACGCCAACGTTTGGGGGCAAGCGCTACTTCGTCACGTTCATCGACGACA
AGTCGCACTTCTGCATGGTGTACTTGCTGAGGAACAAGTCCGAGGTGGCTGCCAAGTTCGCGGAGTTTGTGGCGTTTGCTGAAACTCAGACCGGCAAGCG
TGTGAAGACACTCCGGAGCGACAACGGTGGCGAGTACACCTCCGGTGCGATGGCCAAGTTCTGTGCGGACCGCGGTATCGTGCAGAAGTTCACTCCGCCG
TACACGCCTCAGCTAAACGGAGTCGCCGAGCGGATGAACCGGACGTTGGTGGAGTGTGCGCGCTGCATGCTGGAACATGCCGGATTGCCCAAGACGTATT
GGGGTGAAGCGGTGATGACGGCTACGTTCCTCCGTAATCGGTGTCCGACACGCGCCATCAGCCACGACAAGTCTCCGCACCAAGTTTGGACGGGCAAGAA
GCCGCTGCTGGCCAATCTCAAGGTCTTCGGTTGCCACGCGTATGTGCACGTGCCGAAGGCGAAGCGCACCAAGTTCGACGCTCGGTCAGTGCGCTGTCGG
TTCCTGGGGTACTCGGAGCACGAGAAAGCGTATCGATTCGAAGAACTGGAGAGCAGTCGCGTGCTGGTGAGCCGCGACGCGCAGTTCATGGAAGACGTCT
TCGACAGTGGGAGACGCGACTACCATCAGAGGGAGGTGGTGGTCATTCAAGATGAAGAGACGACGGATCAAGATTTGTCGCAGTCGGATGACGACGACAA
CGAAGAAGAGGAAGAGGAAGAAGCTGCGCGAGACGAAGACGTCGAGCCCGGCAACAAGCGACACCCGCGGACGCAGTCACTGGAGGAAGCCACGGAGGTT
CCAAGTGCCAAGCGGTATGCGTCGCAGAGTCGACACCAGACGCTGGACGAGATGTCTGCTGCGGCTCAAGAAAGTCAAGACTTCGAAGCTGCGTACGTCG
TGGATTCAGTGGGAGAAATGCCGACCACGTTCAAGTCGGCGATGGAATCCAGCGACGCAGTCAAGTGGAAGGAGGCGTGCGACTCGGAGTGTGACTCGCT
GCTCAAGAACGACACGTGGGATGTCGTACCACTGCCGAAGGGACGCAAGGCGATCGGCTGCAGATGGGTGTTTCGCGTGAAGGAGAACCAAGCTGGAGAG
ATTGAGCGGTTCAAGGCGCGACTGGTGGCCAAGGGGTTTTCGCAGAAGTACGGCATCGACTACGACGAGACCTTCGCACCAGTGGCCAAGTTCACGTCCA
TCCGGATCGTACTGAGTCTAGCTGCCAAGTATGGTCTCAAGCTGCACCAGATGGATGTCAAGACTGCGTTCCTCAACGGTGTGCTGGACGAAGACATCTA
CATGGCACAACCCGATGGCTATGTGGACGAAGACCACCCGGACCACGTATGCAAGCTCAAGCGGTCGCTGTACGGACTGAAGCAGTCGCCGCGCATGTGG
AACCAGACCATCGACGACTTCATGCTCAAGCTGGGGTTCAAGAACTGCGAGTCCGACCACTGCGTCTACTTGAAGCGTGACGGCCAAGACATGATCTTCG
TGGCGCTGTACGTTGACGACTTGGTCCTCGCCAGCAGCAACGACGAGCTGCTTCAGCACACGTAG