Transcript Name :
Phyra_g4261
Orientation:
(+)
Number of Exons:
6
Description :
hypothetical protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
STAS domain11.421PS50801
Cyclic nucleotide-binding domain12.678PS50042
*** None ***
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
STAS domainIPR002645
Cyclic nucleotide-binding domainIPR000595
*** None ***
InsideOutsideTMhelix
1-302
303-325
326-339
340-362
363-373
374-396
397-415
416-438
439-450
451-470
471-479
480-502
503-540
541-563
564-577
578-600
601-612
613-635
636-638
639-661
662-669
670-692
693-1066
*** None ***
PositionContextScore
192MVIRETR|SF0.51
766VHIRKSR|SA0.609
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        6424 bases(100 bases per row)
ATGCACCTGCTGCGCCGCCAATTCGCGCTGGTGGACGCCGCCTTTTGCTTCGTGGCCAAGCACCGCGCGGCGCCGACTGTGCGCAGCGTGTTGCGCGTGG
CCAACAGATTCGGCAGCGCGCAGCTCACGCGCGAAAACCTCGTGGAATTATCTACTATCGCCCCAGATCTCCTCGTTTTAGCACGTCCTAACTCAACAAT
CCAGATACGATCAGGCAGGACGACTTCGATTCGACCGAACGTTAGCTTTTAGTTTTTCTCTCACTTTTGTATATTATTTTAATTGCTGTAGACGACGTCT
TCAGCCCGACGCCGTTGAGTGTTGAAGATGTTGAAGTTGTGACGTTCCCGTTGGCACCGCAGACCAGTCAGCGAGCAAGTTCCAAGAGAAAAAGTTTGTT
CGATGCAGCTCTCCAGAAAAATGACAAGTTGGTGGAGAAACAACCCAAGGATGCGGGGATTTCTACTGAAAAAAGTCACACAGCCAGTGTAGCACAGAAG
ACCCCAAATCCGACGCCGAAAAAACAAGTTCAAGCTCACAATGACTGGGGATCGTCGGTTCTGACGATGTTGCAGCAGATGAATCTGTATAGAGATCAAA
TTGTGCACGTGGAGCGGCGTCGCTCATGTGAAGCTCAGTATCGTGATCTGGAGGTGCTGCAGCTGTCGCCACAAGTTTGTGAAGCGCTGGAGAAGTGCTA
CAGCATTAAGGAACTGTACTCGCACCAGTTTGACGCTATTGGCGCGATCCGGCGTGGAGAAAATGTGGTACTGTCGACAGCTACGGCGAGCGGGAAATCA
TTGGCGTACAATGTTCCGATGCTGGATACGCTGCTCCAAGACCCCGACGCCACATTCATGTATTTGTTCCCGACGAAAGCCTTGGCCCAGGATCAACTCA
AGTCTTTGAGACGGTTCTTGAAGGCGGCTGACCTGCCGCTTCACCTTGGCGCAACATTTGTAAGGGACGGTGAAATGCGCTAAAAGAGATGAATAACTTC
TAACTGATGTCATGATTGCTGCTGTCCAGGATGGCGACACGCCCATGAAAAGCCGCTCGATGGTCATCCGTGAGACGCGGGTATTTCTCACCAACCCAGA
TATGCTTCACCTGACAATACTCCCTCAGCATCGGCAATGGAAGAACGTGCTATCAAAGCTCAGGTAAACGTTCCGTTGCGAGTCGCGACTTCATTTGTGG
CGAAATGCTCACAACTTATCTCGTCGTGTTTCACTGGATTAGAATTCTGGTTGTGGACGAAGCGCATATGTATCGAGGCGTATTTGGATCACATGTAGCG
TGCGTATTCCGCCGATTATTTCGCCTATGTGCGCTTTATGGGTCCAACCCGCAGGTGGTCTGTTGCTCGGCCACGATCCGAAACCCGGAAGCACACTTCC
GACAACTACTGCCGTCGCTTCCGCCTCAGCCCGTAGTTGCGCCTGCGAGTGCTCCTACTGATGGCAATCCCCAAGAACGATCAGAGGAGGAATTGGGCCC
ACCCAACCTGCATTTTTTTCGCCAGCGCCCACTTCAGGTTATCACAAAGGACGGAGCTCCGTCTGTAGAAAAACTATTCTGTGTCTGGAACCCAAAGGTA
TCTAAGAAGAAGAACGTGAAGCAAGTGGAGACCGAGCGTGATGAACCCAATCCATCACAACTTTCTTCATCTGCGTTGGCGTCAAGAAAACGCAAGCGTA
CCGAGGGCACACCGAACATATCGAAGTCCAATGATGAAGATCAATCCAGCACGAGCACCAGTGCGATTTTTCAAGGAGCTAGAATCCTTGGTCGCTTAGT
GGAAGCTGAAATCGCTACACTCCTGTTCTGCCGGGGGAGAAAACTAACGGAGCTGGTATTGATGAATCTCCACTCGATTCTGAAGGCCGATGCTAGCACT
CAGAATCTGATTCATCGGGTTTGTTCCTATCGTGGTGGGTATACTCTGGAATCCAGGCGGCGGATTGAGCAGCGACTGTTTAGTGGAGATTTGCTGGGTG
TTGTGGCAACGAACGCTTTGGAGTTGGGTATTGATATCGGCGAGTTGGACTGTACTATACATCTTGGACTCCCATCGAGCGTCGCGTCCTTGTGGCAACA
AGCCGGTCGTGCAGGTCGCCGCCAGCAGCAATCTAAGCAAAAGCAGTCTGTAGCGATCATTGTGTGCTTTGATGCACCACTGGACCAACACTTTGCGCAG
AAGGAACACGCGCTGGAGCTTTTCCAACTGGAGCCAGAAGCCGTGAGTCTGAACCCGATGAATCACTGTGTCCTCGGTCAACACTTGCTGTGCGCTGCCC
GTGAGTCAGCGCTTTATTCTCCACAGTCTGGAACGGCTTACATTGACTCGTACGTATTCGGGAGACTGTCTGAAAGCCAACACGACGGAGGCCACATGAG
CGTTGAAGGCGGTGGACAAACGGTGGTGTCTGAGGTCGACGAGATACTCCAGCCTCTTGTGAAAGAGCGCAAGTTGATGCAGTGTACAGAGGCTGATGGA
CGCATCAATTATCGAATTCATTCGTGTATGCCGAAAAAGTTTCGTGCTGTGAGCTTGCGCAGCATCTGCGATGAAAACTACTCGGTGGTGATACCAAGCA
ACAACGTTAACAATGATGGAGTCGATGGTGAAGTACTGGATGAAATCCCAGGCGACAGAGCCTTCTTCCAAGTGTACCCCACCGCAGTGTACCTTCACCA
GGCACAGGAGTACCTGATCACACGCCTGGACAACGTGCAGCGCATTGCATTTGCGAAGAAGTGCCAGCAACCACTCACGTACTTCACGACTTGTCGGGAT
TGCACAGATCTGGAGGTTGTACGCATACATAGTACTGCGCACCTTGAACGTGGTAGCGAGAAAGCAAACTGCGACTCTGTTCTCGTTTGTGTGGGAACCG
TTTCCATCTTGACACGGGTTTTCGGGTCAACGATGCTGGAAAAGCGTACCATGCGAGCGTTGGGGACGAACGAGTTCTCTTTGCCACTCATGCAGTCGTT
CGGGGAAGCGGTGTGGCTTGAGTTTCCAGCTGCAATTCGCAACCAAGTGGAAGTCAGGGGCGGATCATCGTGGACTGCAGCACTGCATGGTGTCGGCCAC
CTCTTTGTAGCTGTGGTGCGTCTGTTTGTGCTGTGTGATGCGGAAGATGTTGGCACCGAACATGTGAATGAATTCGAGCAGCGCGTCAAGTACGTTGGTG
GTGCGTTACCGACGACGGACACGGTGTTAATAGTTGCTGGCTCTGTGTGTGTGCTGTACAGACCAAATCGCGTTACGATCTTCGAGCGACGAGAAGGAGG
GAGCGGTTTAGTGCCCGAAATCGTCAAAGTGCTCCCCAAGGTACGTGAAAGTTTCTTGTTACATTGATCTCACGATACTTATCTTACCTCGTAGGTTATC
GAAAAGGCATGGGCGATTGCAAGCGAGTGCTCGTGCTCGGATGGCTGTCCTGCTTGCATTCAGTCAGCAGGATGCTCGGAGTTCAACCACGTCTTGGATA
AGCAAGGCAGTCTGCAGATTCTCGATTTTTTACACACTGTAGTTGGCCAAAGTTCTTCCGAGGGATGAACACCACCAATCTTACGCTTAGGGAATGAGTG
CTGAGGAGTGAGTTGAAGCCTGAGCCAAAGCGAGGCGAAGTTTGTAGCAAAGTGGTAACACACGTAGTGACAGCCCGTACCAATAGTTTGGTACCCATTA
GTCACTGATGCATGGCCCATCACCTCCAGGAGAGGTCCAAAACGTCAGCGTCTCACTTGCTGGTTCACCTCCATCCAGTCATCGCACCTTCGACACTTGA
GCATGTACTCGCCCGCGCTGTCGGGTGCAGTCAAGCGCCGCAGCAACTCGGGGACGCGCGCACCGGCGGCCGAGCGCGCAGCCCAACGCGAGACCGAAAC
CGCTCGGAATGACCATCGGAGCGCCGCCGCCGCCACCGCAGCTGGGTGGACGAGAGCTCGCCCTTCAATGGGGAGTCCATGGCGCTGCTGGTGGACAATG
ACTCAACGACGGACGGACGTGGAACCAGCAGCAGCGGCGTCTTTAGCCCGCAGCAAGTGGCCAAGTTGACGAACGCCCTCATGTACGGCGTCATCAACTC
CATCCTGACCATCCCGTGCATGTACGGCTACGCGGCCATCATCTTTGGCCACCCGGACTTCGCCGCCTTCATGCCGGCGCTGTCCAAGCTCGTCATGTTC
TCCAGCGTCGTGCACCAGTCATGTTCACGCTGCTGAGCTCGCTGCCCTTCGCCATCGGACAGGTGCAGGACGCCGGCCTCATCTTCCTCAGCGCCATCGC
CACGTCCATCTGCAAGTCGCTGGGCGAAGACGTGCCGGTGGAGGCCAAGGTGACCACCACCGTGGTGACGATCGGCCTGGCCACGGCGTCGCTCGGAGTG
GTGCTGGTGCTGCTGGGACGCTTCAAGCTGGCGGGACTCGTGTCGTACCTGCCCATGCCCGTCGTGGGCGGCTATCTGGCGTTCATTGGCCTCTTCTGCA
TGTACGCCGGCCTCTCGCTGTGCACGGGACTCGTGATCAATGACTTCACCTCAATGATGCAGATCTGGGAAGACCCGCACTACCTGCTGCTGTGTGTACC
CGGCGTTTTGGGCGGCATCGTTCTGCTGCTGGTGTCGCAGCGCTGCGAAAACAACTTTGCGCTTCCTGCCACGATTCTGCTCATGCCGCTGCTTTTCTTC
GCCGTGCTGGCGCTGTGTGGAGTTTCGTTGGACGAAGCGCGCGACTACGGATGGGTCTCGCCGGCTTCGGACCCCGCTGGCTTCGTGCAGATGTTCGACC
TGTTTGACTTCTCGCAAATGCACTGGAACCAAGTCCCGAAGCAGTTTACGACGTGGCTCGGGATGACGTTTGTTGTGGCCTTCTCGTCGTGTCTGGATGT
GGCGGCTATCGAGATGGACATGGGCAGTCAGCTGAACATCAACCACGAGTTAAAGTCGGTCGGCTGGTCCAACGTCGTGAGTGGGTTGCTGGGCGGCTAC
ACTGGGTCGTACATCTTCTCGCAGACTATCTTCACGTACCGTTCCAAGACCAACTCGCGCGTCGTGGGTGTGTGCGTGATCATCTCCGAGTTCGCCATCG
TCCTTGTGCCGCTGTCCGTCATGAGCCTCGTGCCGCGATTCTTCTTTGCAGCTACGCTCATCTTCATCGCCATTGACCTTATGATGGAGTGGCTTGTGCA
CGTGTACCACAAGGTCCTGCCGCGCGAGTACGTCGTGCTGTGGCTGTCGTTCATCGCCATCAACATGGTCTCGCTTGAGCTGGGAATGGTGCTTGGTGTG
GGTTTCGCGATCCTCAACTTCTTGCTGGGTTACGCGCAGGTCCGTGTCGTGAACCGCCGGTCACGATCGTCAGCTTCTGTGCGCAAACTCGCAGCGCGCA
CTTTACTCAACCAGAAGCGTGACGCCATCGTGTACCTGGAGCTGTACGGCTACCTCTTTTTCGGCTCGTCGGTGCAGATTCTCCAGGACGTGCAGAAGGC
TGTCCATATTCGCAAGTCCCGCTCTGCGATGAAGCAGAAATCGAACAGAGGACTGGATGAGCCGCAGTACGTTGACGATTCCGGGATCCCACTTACGCCT
GTAGCAAAGCGAGATGTCCCGATCGAGTGCCTGGATGGCAGTCCTGCGCAGCACCCGGATGGATTGCCAACCGAGTATGTTGTCATGGATTTCAGTCGCG
TCTCCGGTATGGACGCAACGGCTGCCCGCAGTGCATTCATGATTTTGCAGCAGCACTGCAAGCGCCACGACATCACCGTCATTTTTGCCGACGCGCTTCC
CGAGATCCGCAGCCTGCTGCTGAACAACGAGATCGCTGAGGAAGAAAACTTCTTCCTTAACGCTGAATCAGCCCTGGAGTTCTGCGAGAACCACCTTCTG
GTGAATGCTAACCAGTTGCAGGATATCAACCATCACCACGAGTCCATGAGTGTGTTGTTGCACCGCTTCATGGGCGAGCCGGATGACTCGCACCTCTTCC
GTGGTGTCGACCAGTTCTTCCGCAAGTACGAGGTGCCTGTAGGCTACGAGTTCTACCGCGTCGCGTCATACCCGGATCGTTTCTACTTCCTCGCCAGTGG
CCGTGTTGCGCTCTTTATGAACGACGATGGTACCGTGGCTCCAGGGAAGTCTTTGACGCTGCTGGAGAGTGTCTTGCCCGGTGCCATGTTCGGTGAGGTC
GACTTCTTCGGCCGTCAGTACCGATACATGGCTGCCAGAGCGCTGGAACCCTGTACTGTGTTCGAGATGTCCCGCGAAACCTACGAGTCCATGGACGAGT
TGGCGCCTGCTCAGTGGAACCGCCTCCGCGACGTTGTCATGCAGTCAATGGCACTGTCAATCACCAACACCACGTCCATCAACAGCCTCAACAACGCCAG
TGGCAACCTCCCAGGACTCAACTG