Transcript Name :
Phyra_g8472
Orientation:
(+)
Number of Exons:
4
Description :
hypothetical protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Stem cell self-renewal protein Piwi15.905PS50822
HmmSmart predictionP-Valprediction_id
Stem cell self-renewal protein Piwi0.00011SM00950
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-501
*** None ***
PositionContextScore
352DLSRKKR|QR0.703
*** None ***
GO
Biological ProcessGO IDPrediction Method
protein bindingGO:0005515IEA
*** None ***
*** None ***
Sequence
        4154 bases(100 bases per row)
ATGACTCTCGACGGCACGATGATCGACGTTACAGCGCTCGTAGCATTCCTTACGGAGGTCATGGCACATGGCCATTTCGTGCCGACAACCCTGACGACGA
TAGATCTCCATACTACGCTCGAGGCCGTGATGCTGGCAACTACGGCGACTATGACGATAACTCACGTGGTTATGAAAGACATGACCGACAACGTCCGAGT
TCCTTCCGTACAAATGGAGGTCGTCACGATGAAGGAGAAAGAAGCGGGCGTTTTGGCGATAGAGCGCGCAATCACGATACGTTCCGCCGTGGTGATGGAG
GAGGCCGCCGTGGTCCTCGAGATGAAGGTGGCGCTGGTGCAGGTTTCGTTGCTGGGTCTGGATACGAGGAGGTTGGTAATCCCCTTTCCAACTTACTCGA
AGTAGACGAATGGAGTGCCGCGCCGGTGCTCGACATGTACGCGCTGACGACGCCGAACTTCAGCAAGATGTGGCGGTTTGTCATCGGCCCCATGTTGCTG
AGAGAGGGAGGACTGTGCTGCTCAACATCAACTACTTTAACGTCTCAATCGACTCGGCGCTTCGAGAGATATTCAAGTATCATGTTACTGTGGAGCGTAC
AGCGTCGAGCTTGAGATATGGTGCTTCAAGTGGCGACCACCAGGATGGGGCTCCAAGTGCTGTTGGTGAGATACTGGAGCGTCAGAGACTACGAGACAAG
ACCACCAAAATGATGTTGCAAGTGGTGCTCGCGATAGTACTGGCGCGTCAGAAATTACGACACAAGAACAACGACCAACACGACCGCTGCAGCGTTCATT
GGTCCGAGACGTTATCAATGCCGCCCTTCGAAAGTTCGGCGAGGAGTTTGCTGGTGTACGTGTGGTTCATGACGGCATGTCGGCTCTCTACTCGCCTGTC
ATTCTGCCGTGGAGCTCAAAGGAGTTTGCTGATGTCGATTTGGGCGGCGTTGGCGTCAACTCGTTCGTGACGTCCAGTGAAGGTGCCGTCAGTGCATCTC
GTCGTAGAGGCCCGCGAACATTTGTTGTAAAGGTGAACCTTGTGGAAACAATCTCTCTTTCGACTTTGGAGGACTTCTACTCCGATGCAATGGTGAATGT
CATGCCCGTGCTGCAAGCTCTGGATGTTGTTGTCCGCCATCTCGCAGCGCAACGCTTGGTCGCGGTAGGGTCCGAGTTTTACAGCTTGAAGAAAACCCAC
ACACTCAATGCCGGCAAAGAGCTGTGCTGGGGGTACCATCAAGCGATCCACGCCGCAGAGCGCAAACTGCTCGTGAATGTTGACCAAGCGACGGGGGTCT
TCTACTCCCCAGGCCCTCTCATGCGCCTGGTTACAGCTGCGTTGCGCGTACGTAGCCCTCGCGAAGTCCAGAGATTGTCGGACCGCCAGCTAAAGGAGCT
AGCGCGTGCATTGCGAGACGTGGAGGTGATACCAACACACCGCAAGGACTGCAAACGTGCCATCTGCGGCGTAAGCGCCTTGTCTCCCCACCAGATATTT
ATGAACGCTAAGGGTAAGGAGATATCCATCGCTGGCTACTTCAGCGAGCGGTACGGCAAGCACTCGAATACCCGAGTCTGCCACTTGTTAACGTTGGCAG
CAAACGCCCGGGAAAGGAGACCTGGTTACCAATTGAGCTTTGTACCGTAGCACCGGGCCAACATTGCGCCAGCTCTGAAGATGTGGATGCACCAGAGATC
ACCCGTTTGACTAGCCAGCCTCCCCAGACACGCCAAGCAAATATCCTGGAGCACGTACGACAAGCACGATTCGAACATGACCCATTCTTGGAGGCCTTTG
GCATGAAAGTGGAGCAACGTTTGCAGCGAATTGAGGCTCGCGTAATGGACGGTCCGCACGTTCAGTACCAGAACGTATCAGTGCATCGCTCAGACGGGCA
ATGGAGCCTCAATGACAAAACGTTTGTCAAAGGTGTCCGTGTCCGCAACTGGGGTGTGATCGTTCTTGCCGACGTATGGAATAATGAGGTGCGAAAGTTT
CTGCAGACGTTGTGTGAGGTCGGGAATGGACACGGATTGCCCTTCGAGAACACACGCCCCGAGTTCATTCACCAGAGCGAAAACCGTGGAGTGGGCGTCG
ACGAATTGATGACCAAATGTTTTCGACAGCTTGAGAAGTGTCAAGCCGAACGCCGTGCAGGGCCTCCGCAGCTATTGCTCGTAATCCTGCCAGACACAAG
TTCCTTTCTTTATGGAGATGTTAAGAGGACGTCGGACACTGTTTTGGGCATTGCCAGCCAATGCATTGCATCAAAGAACCTGCGCAAGGCGAACGCCGCC
TTTTGCGCGAACGTGTGCTTAAAGATTAACATGCGGCTGAATGGCAAGAATGCGGTTCTGCGTGGGCCCCTCCCGCTGATAAGCACTGCACCACGATCCT
AGTTGGCGCCGACGTTGAGTACCCGCGGCCAAGTTCGGACTATCAGCCAGCAATTGCTGCTGTCGTGGCGTCAATGGACGCGTATTCGGCCCAGTACGCA
GCACGGGTGGCTGCTCAAAAGTCGAGCAGCGAAATTCAAAGGCTGCCGCACATGTTGCGGGAACTATTTCTTGCTTACTTTGAGAACACGAAGCGCAGAC
CAGAGCATGTCATGTATTATCGAGGTGGAGTGGGCAAGGGTGAAATGGTGGACATTCTTCAGGCGGAGTTGCGTGCCCTGCGTATGGCGTTCAAAATGAT
TTCTGAAAACTACAGCCCGCTGGTTACGTTTATCGTGGCAAACAAACGCCACCACACACGTGCGTTTCCGGTGAGTCCCCGTGACGGCGACAGGAAGGGA
AATGTGAAGCCAGGCACTGTGGTCGACGCTGGAGTTGTTGACCCTCATCGGTCCGAGTTTTTTCTATGGGGGCACACGAGTTTACAGGGTACCAGCAAGC
CGTGCCGGTACACGGTCTTGCACGATGAGAATAATATGTCGGCGGGGGACGTGCAGCAACTGACGTATCATCTCGGATACACGTTTTCGCGATCGACCCA
CTCCGTGTCGGTCGTCACTCCCGTCTACTATGCGAATGAAGCTGCTGCGCATGCTCGTCACTTTTTACGGGAGGAGCCAAGTGGGGAATCTACCGACGGC
ACAAGCCAAACAACCTTCAGCTTTGCAAAAGTCCACCCAAACGTTCTTAACCGCATGTTCTTCATTTGAGGATGGAAAGATGAAGCAAGACTGTTGCAGG
CAATGCGGGAAATTGATTCTTCTGTTGGCTTGAGCTTTTTGGTGGGCGGGGTTGCTCTTCATTTCGATGGCAGCGAAATACTTCGAAGTAGTTTTCATGA
GGACGAAGAAGATAAGGTAAGATTGAAGTTTTTGATTCCGACTTGGATTGTAGCCATTTTATTTCCGATAATGAACGCCTGATTACATAATCCAACCTCT
CTAACGTCATAAACGATACCAAACTTGACGGAAGAGAAGCCTCCCCGCTGGCTCCCGTTCAAAGGGTGGAAAGCAACCACCACAGTAAAACTCCCCAGCT
CCGTAGCGTTTCTCCGTTGCCATGGCCTCCATCGCCGCGTCGCCAGGTACAGTCTCCCCCCCCTCTCTCCTTCCCCCTCCACCGTCGGCCACCTCACTCT
CTTGTGTCTCTCTTTATGGCCCGCTCCCCCCTTGCAGTCTACCCGAACGGGCTCAAGAAGCGCTCGCGACTGACCGAGTCGTACGATTTGTCGAGGAAGA
AGCGCCAGCGCCAAGCCAGCAATGGCCAGGACGAGGCCGTCGATGAGACCGACGTGGCCAAGTACAGCCAGCGCCACGTCGAGTACTTTGAGCAGGTGAA
GCAGGCCGAGATCGCCCGAATAAGGGCCGAGTACGAGCAGTTCATCATGAAGAAGGACGCCGAGTTCCAGCGGCTCGGCCAGCAGCTGCAGCACACACAG
GAGCGCGTGGCCGCCCAGGCCAGCGATGTGGCCCGTCTCCATGGCGAGAACAAGCTGCTGAAACGTGCAGTGGCCATCCAAAACCAGCAAAAGGAGGAGG
TTCAGCACGAGAACAGCGCGCTCAAACAGCTGGCCACGCAGGCCGCCGAGCACATGAAGCGCCTCGAGCAGGCCAACTACACGCTCAGGGTCCACCTGCA
GACCAGCACCAGCGCGGGCAACGGCCACCACTACCAGCCGCCTGATGTGTACTA