Transcript Name :
Phyra_g8473
Orientation:
(-)
Number of Exons:
7
Description :
hypothetical protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
HmmSmart predictionP-Valprediction_id
Notch domain0.0057SM00004
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-507
508-530
531-1648
1649-1666
1667-1726
*** None ***
PositionContextScore
7MAARGRR|RR0.503
9ARGRRRR|DA0.745
37EAARRRR|RL0.519
154ARNARRR|QV0.527
447MKERSRR|LY0.546
*** None ***
GO
Biological ProcessGO IDPrediction Method
membraneGO:0016020IEA
cell differentiationGO:0030154IEA
*** None ***
*** None ***
Sequence
        10384 bases(100 bases per row)
TGGCGGCGCGCGGCCGACGTCGGCGCGACGCCAATCTGGGGCAGATCCCTCTGAGCTCGGGCGAGATCGAGCTCTACTCGCGTCAGGATGAGGCGGCGCG
ACGACGGCGGCGTCTGCTGGCCGTACGGGACCAGGAGCGGCGTTTGGCGCAGCAGGTGACGCAGCGCTACCGCCAGAACCTGCAGCGGCTGCAGCACGGG
AAGAGCCAGAAGATGCACACGCAGCTAAACACTGAGCAGCGCGCACAGCTGACGGAGCTGCACCGACGCTACCAGAACTCGCTGCAGAGCATGGGCACGG
CGCAGCGCAACGCGCGCGCGAAGCTGCTGGAGCTCATGGAGCAGGCGCAGCACGAGCAGGAGAAATGGAATTACAACCGCCAAGTTACAGGGAAAGAACG
TGAAATAGAGGCACAAGAAGATCGAGAGGAGGAGGAGACAGCGAGGAACGCAAGACGACGACAGGTGGAGCAGAATATGCAGAGACTCAAGCTCTTAAGC
GGCCAGCAGAGACGACAGGCCAGTGATCGGGCCAGACAGGAACAACTGGCCATGCAACGGTCCAAGGACAGAGAGCAGTTGGAGCAAATGATACAAATGC
AGAGCCCCGAAGAGGTGTTTGTCACCCCTCGGCCACACAGGAAGGACGTCGTGTCGTACCAGTTTACGAGGACGCATTGTGTTGCACCTGCTGTGTCGAC
TGGCAAGGAGAGGCCGGCGGTGACGGTGATTAAACATAATAGGAAGCACCCGACTGCGAGGCGTGGAGAAGATGAGGCGAACAAGTACAGGGACGAAGTG
GACCAGAAGCGAGAGCGTGATAGACTGATAGCGAGGAGCAGAAAAAAACGGCCGCCGAGCGCGGCAAAGTTGCGGTGGACGATGTGACTTCGAGACAACA
GGGACAACAAGCGTTGGAGTGGTTGGCGCTGGTCGATAAGATGGAACGGCGAGGAAGAGGACAGGAATTGGGCGGTGGAGATGAGTATCTTTTGGATGTT
GGTGAGGTAGATGGAGTTGACGACCCGCAGCTAATGGCTGAACGGGCATTTGCGCAGATGCTTGGCTTAGAGGAAGACTCGATGGAGCTATCCGCTTTCT
CGATCGAGACAGATGACGATGAGTCAGAAGGTTTGGCAGATATAGACCGTGAACTTTCAGACAACGTCGAGCCTGTGAAGGCAAATGCAGAATACAGAGT
GAAACTTAAGGCGGGCAAGGGCAGTGGTTCGCTTGATTCGCTTGAAGAAATCGAGTCTGGCCGGGTCGGGACAAAAGACAGAGACGGACGAGCTGAAGCC
ATGTACGACAACACTGAGAAGCCTTTAAAGACGACTTCTTTCGGAGACGATGAGCGCCAGGAGCTTAAGAAACTCAAGAAAGCAAAATACATCCAGAAAG
ATAGTTCGCCATCGAAGGGTGTACTTATGGAGACCCGTAGTGGAGTGACCGTCGGGGAGTACGAAGATAATTCTGGGAAGACGGGGGAGAGACCATTTAC
AAACGGTGGTGACGATGCTCTGCCGGAGGCATCGGCTGTACAGTGGAACACACATCGATATAGCAAGGCTGCTGCGGAGGGCCGACGCCGAAACAGCTAC
GGTAGTATCGAAGAACGCCCTGAAGGTACCGATGGTGAAGATGACGAAAGGCATCCTCCTTCCCACCGCCCGGAGCGAGAAAACGGATCTATCGAGCGAT
TAGAAAATCGGCTACAAGAAGTTTTGGATTTTCGCATGCCCAGCCCACGACGTGATCAACTGCCAACTACACGTCAGCCTGCAGACGATCAAGAATCGTT
ATTCTCTGGCTCTGAATCGAGTCACCGTGCTAGCCAACTCGATGAACATGATGCAGGCTTACTAAGAAGGAGTGGGGCATCTGCATCCCCGTGCAATGGT
TCCAATGCTGCAGGGAATACTAGAGCTGTATCTTTGCCTGCGAATGCGGGAGAAAGAGGCTCACCTCCCTTATCTTTTTCTGCAACTTCTGAAGCCGTGA
TGCCTGGTGAGCACCGTCATATGTCAACGGATGATGAGAATCTGTGGCGAGTGAGGGCTTTCCCAGACAGGGTTTCTTAATTACAGCAGCTCGAGTGGTA
TCAGTGAACAGCATGATGATAGACGTGTTTCAAAGGATGATTTCTTGCATCCTCGGGAACGAGGGCCTGGTGACCACCAGGAATTGCGTGTCGGTGGTGG
TGATGCATTCGGAACCACGCCAAGAATTAATGGAGAAGCGGATATTGCTGGCGATAGCCGACTGGGCTACTCGCCTGCATCTTCGAGATCAAGTTATCAA
TCTGGACGTTATGATGTGGATTATCATGGACATGAAGCGATTGAAACTCACCCCGAAAACGTAAGTGGTGTTGGCCCGCCAGAGTTACAAAGAAATGAAA
TCGAGAAAACTGCTCGTAACAAGGAGGTTGATGGAAAGGCAGGGCAGGATCATAGTGCAGTTGGCCTGTGGAGCTCATCGGCTCAAGAAAGGGCTATCAA
ACCGCGGGATTCAAGAAATCTCTCGGCCACTGGACGTTCGGAGGAAATGCTAGCTGAGCATGATGAAAATTTATCAAGTTCAGTGTCGGCTGCTTCTAAT
GATGAGTTTCGTCAGGAGCCAACCACTCTAGGCGACAAAATCTTCGCGTAGTTGCTGTTGAGGAAGACTCAGTATCCGAGTCATCCTTCGCTCCCAGCCA
GAAGTCTATCGCACGTCTTGATCAAGTGGCCAAGAACAGAGAGAGGTCGCTTGGACAGCGATTCGTCGACCAACATGTGCTCTCTTTTTCTTCATCAGAG
GGGTTAAGTGACGATGAAAGGGGGGCTGAAGGCAATTTATCTCGTCCACCCAATGGCACTGGCGATGCGCACCCGTCCGTGAATATCAATCCACATGATC
CATACCGTCTGCAGATTGACCACCAAGCCCGGAGAAGCAGCACGTCAGCTATCTCTGTCGCCCAGTACTCACTTCCGCCGTCGGATACGCAAACCTCGTT
TGATGACAGTTTGGATCAGCTACACCCTGGCTACGGTGAAGACAGTTTTGTGAACGAATTGGTACCAATGTTCCCTAAACGTGCATTGCCGCATCCCTTC
GAAGAAGACAGTCAAGCAGTGGAGGAGTACGAAGTTCAGCTGGTGGCTCCAAATATGAGCAGAATGCTAACGTCAGATAGACGTACTTCTTTTGGTCGTA
GTAGGCAACGCTTGGTGCATCAAGACCACGAGACAGATGCTGCAATCGACCATACACGCCGTCAACCCGCAACAAGACGTGAAGAGGTTGGTGCTGGCGA
TCGGGTACCCCAAATTGATCAGACAGAGTTTTCGTCACTTAATAGAAGAAGTCCGCGGGGTCTTCGAACGATGAAATGGACGTAGAAAGTGTCGAAACTC
GATGGACGAACCGCAACAGCAACAACAGCCAGGTATCAAACATACTCGACGAGCATCAACGCGCCCTAGCACGGCTGGTAGTCACCAGAGCAGGCCAGCT
GGCATGATTGATAGCAACGCAGTGGACAATCTATCGGAGATCTCAGACAGCGACTCCGGTGTTTCCAGTCTTGGTTTTGCTGTCCAGTTGAACCTTGTAG
CTGGTACTACCCGGAGACGAAAGGGTAGCGATGGCCGACGAGAAGCCCCTGTGCGTGCTGCAAGTCAACAAACCAAGCGCCGATGCAACCACCTCTGCTG
ATGATTTGGACAACGAGGACAACGTTTCTGACAGAAGTTTCGCGTCCAGTTCTAGCATGTCGATGGATGCTCACTTCAACTACCTCTCCAGCATGACGTC
GGCAGTGGGGAAGTCTTTGCCTTTGCATCTTCGATTGCCCGCGGTGATTTTTGGCAAGAAGGATATGACCAAACCACCGGTACCAATAGCTTGGTCAGCG
TCGTCTGAGTCTTCAATTGCAAGTGCAAGCGAGTTAGATCCCATCGAAGCTGTCGAGAGGGGTTTCGCTTTCGATAGGAGTAAAACTTCTCGTTCAAACT
CGAGTAGGAGTGAATCTCTCCTTGAGGAGCAACAAGGTCAGCGTAAGATGAACTGGCAAGTGCGTGGCAGTGACTCTTCCGCTGGCAGTCACCAGAGTAA
GGCGCTTGACGAAAGCAGCTACAGTGAAAGCACGGATGAGTCTGAAGGCTGAGCGTGTGACATTCAAGGACATCAAGGAAAAGGTTGCGATGTTGCCGCC
ACCTCCACTAGGCTCACTTGATATGACGCAGCCACCAGCACCTCTGAAGAACCTCGAGCACTCCTTTGCTGGCTCTCTCTCGTCGTCAGAACAGAGCTCC
GAAGGCTTCCAGTCGTCTGAGAGGCGTCAAACACGTGACCATGACCGCCGTCCTTACGAAGATGAAGATGAGAGAAAGTCAGGCGGTTCTAGCAGCGGCA
GCGATGAATCCTCGCGTAGCAACGATTCTTCAAGCAGCTCTTTTGCAAGCTCAAGACGTCAAAGCATGAAAAAGGCTGAGAAGATTGTTATCCCCGTGAA
GAAGACACGGAGTAACAATGACAGAGATAGCGACGGAGATGAAGCTGGGAAAGAGATGTCTCTAGCAGAAGCGTTTAAGCGACGCCATCCAAGCTTCGGA
CATCGTGTTGAAAGTCACCACGACAAGCTGAAACGCCATCGAGACCAACAGCAGCAACAGCGACAGCAAGAGCCTGAACAAAAGACTCCTGCAACGCGTG
ATACGAATAAAAGTGAAGCTGCTGCACCAGCTGCCGACCCACTCCCTCCTGAACAGCAGGAGCTGCTCGACCGATTGGCTACGGGCAGTCGGGCCAAGAT
TTCAAGCCGCGAGATGAAGGAGCGCAGTCGCCGGCTGTACCACCAACTCCCTGAAGTCGTCGAGCGCAAGCGCCAAGAAGAGGTCATGCGTCGACGTCGA
GAGCGACTCAACGAGCTGCGCGAGCAGGAAAAGGTGCGTCACTGAACCCCCGTACTCGACAGCATGCACTAACCTTTTCATTTCACTCGTCAGGAGCGGC
GTCTTCAGCAGAAACAGCGTTGACAGCAACAACAGGACCGCTAAACAGCACTCGACCATCGGTAAATTACTATTTAGAAACTCCGTCGACGACCCCATCT
CTTATCTTGGTAGTTAGCAGCATCCACGCTACTGATTGTTGGGTTTCTTGGCATTGTCGGCGTCGCTGAGGTCCGGAATGGTCTGGAGCACAAGGGATCA
GCCCCAATTGCAATACACAACCAGCCAATCGACCATCCATACGCACCAGATCGGGCTTGAGCACCGCGTGCATGGCGCTGGAGCCCGCGAACAGCGAGCC
CAGCGTCGCGCTGAATAGGACCAAGTACTGCTTGGCCGTCACTCTCGCCATTGCCGTTCGTTCACAAATGCTAATTTTTGGTGATTTAGATCTGATTGGA
CGATAGAGCTGTCATAGAGCCTTCTGATTGAGCGTAAATCTGAGGTTCATGATCATTTCTATTTGTCTGCAATGCTGCGTGGTGCAGTGCGCCGCTCCAG
TGCGGCGGCCAAGCAGGTGCCGCCCACTGCGCGTCCCAAGAAGCACCACAAGAAGAAAAATCACTTCGCGACGTCCGGACTCCCGCTCGTTCTCTTCATC
GTGGGTGGATACGTGGCCCTGACGCAGGTAAAATTAGGGAGTTGCAATGTGGTTGGAGACCGCAATCGCTGACATTTGGTGCTTGCAGTTTGTTGAGGGC
AAGTTCGAGGCGAGAGACCACCTGGTCAAGAGCCAATCGGAGCACATGTTCAACTTGGAGGAGGAGCACAAGGTCCGGATGCTGCCTCAGGCCATAATTG
CAAGGCAAAAGGAGACTCACTTGCTGCTGCTATTGTGATGACTGTAGAGAATGACCAAGAAGTTGACACTTGACGAGTTTGAGATCAAGCCTGTGCCCAA
GCCCAAAGATGATTAGACGGAGTACAGCCTGGTAGAGGTACACAGATCGACCTGCGCTTTAACTTTCGCCGAGTACTTGCAAACACTTGACTGAGAAGAA
TTTGTCAACTGCACATCATCATGTTTTACAGCGCAATAGTGATAGTCGTCGCGCAAGTCATGCGTACCCAGATTGGAGATGCAGACTGCAGTTCGCAACG
ACCTGGCTGTCTGCAGGTCACACTGAGAGAGAGAGAGAGAGAGAGATGCACTCTCCATTCATTTCTGTTTGAGCAAATTCACCTTGAACTAGCAAGAATA
AAGCAATTTTACGCCATACTTCTCTGTTGGCTTGCTGCAAACTTGTCGCTTGAACTTTGCATCGCTCTGGTCAACCGCTTCAACCAGTTGTGTACACTTT
ACGTCCCACCTTCCCCCTCTTAATTCCGACATCACTTCCAAATCGGACACGTAATGGCGTCGTCGCGTTCCCGACGCGTCTTGGAGGATGCGTCCGTCCC
CGTAGCGCGGCGCTCGAGCGCTCTGTCCGCTCTGCTCTTCTGTGCGGGCGTCTTGGCTACCTGCTGCGCATTTTTTCTGCTCGATTCCGCGCCTGCGTCG
CACAGCAACATCGGCGGCGTGCAGGCCTCGGACTTCCTGAATTATGGGCCAATCGACGTCGTGTACACGTGGGTGAACGGCACAGACCCGCGTTGGAAGG
CGGAGAAGGAATTCTGGCACAAACATTGGATCGCATCGCTCACCGGCCAGCCGCTGCCCGTGTGGGGCCAAGAGGCCGAAGTCAAGGGCAAAGACGATTC
GAACTCGGACAACCGCTTCCGGGACAACGAGGAGCTGCGGTACTCACTGCGGTCGCTGGAGAAATACGCGCCTTGGGTGCGCCACATCTTCGTGGTCACG
GACGGCCAGATCCCGTCGTGGCTCGACATCGAGTCGCCCAAGCTGAGCATCATCAAGCACCGCGACATTTTCTCCAACGAGAGCCACTTGCCGGTCTTTT
CGTCACCTGCAATCGAGTGGAATCTGGACAATGTGCCCGGACTGAGTGACATGTTCTTATATTTTAACGACGACGTGTTCCTGGGCTCGCCCGTGAGACC
TGAAGACTTTGTGAGCCAAGCGGGCGTGCAGAAGGCCTACTTTGCCTGGGAGATCCCGCTCTGCTCAAACCGGTGCTGGGAGACGAGCTTGGCCAATGGA
CGCTGTGATAAGGAGTGCAACGTCACGGCGTGCGACTTTGATATGGGCGATTGTGGCTGTGACGTGAACCCGCTGGACGGATCCGTGACGTGTGATGCAG
ACAAGATTGCCAGCATTTTGGAACACTCGCCCAACCCCCGAAGATTGGCAACCATTTATGTCAGGGAACGTGTCATTATCAGTGGCTGGGCAATGGGGTT
TGTGACCGCACGTGCAACGTGAGCTCGTGTGCATTCGATGGAGGTGATTGCCGTGTCCAAAAGTCGTACGACCGACATCGGCCCCATGTTCATGACGTAG
AGGAAGAAGGATTATCGCCGCTGGTGATGGACCTGTTTTCGGCAGAGGTTGAACGGAACCACACGCTCGTGCAGGTACCACTGGATGTGAATGCTACGTA
TTTCAACCTTACGGACGCATTTGGAGTTAGCGGCAGTATCTCGAGTGCTGCCCATGACAACGAGGAGCTGATTCGCTTTGCTTCGGTCTATGAGACCGAA
ATGGTTCTACTGCTCGTGTTTGGCCGCGATTCAGATGCGCATCCAATGACGAGCAGCGCCCAGATCACAGTTGCTGGTGAGGATGCTGAGGGAACTCCTA
TCCAACTCGACTTTTCGTTGGTGAGAGGAAAGAACCAGATCGAGCTGCTTTCTAGCTCCGACAACACTGAAGAAATTTCTGCTGGTGTGTCTACATTCCA
AAACACAAGTGTCCGGCCACATCATATTCGGCTACCTTTCGGTTTCCGCCAAGCCACTTTCCGCAACGTTTTCCCTGCTATCGGCGAGGAAACGGATGTA
GCGCACAGCACGGAGAGGACGGAGACACTAGAGGCTGAGAAGACCCCATCGGACTTGTTCGTTGATGACCAGATTGCTGTTGTTGCCAACAAGCTGGCTA
GCAAGGTGCCACTAGTGGAGATTTTTCTGCCCTTCAACGTCACTGGAAAGAAACTAAGTGACGGAGATGTTCTGAACCTCGGATGGCACATGGATCTACG
CCTTCACAACGATGAAAAGGATATTGACTGGAGTGATCACGACGTCTGCCAACTTCAGGTTCCGAAGAAAAAACCTGTCGCGCCTCCTGCTGAGACTGCT
ACAAGGGAAGCTAAGGAGAATACGGTCACCGATGGCAGCAAGCACGATACCTCAGAAGAGAAGGAATCGGCTGAGGACGAAGTTGTACCTGGTATTGCTG
ATTCAACGGGGGAGACGAACGACGACAAGACCCTTGAACAAAGTGACAACCAGCAGGATGCTGTGCAGGACGAACTCAAGCACGACGAAAACACTGAAGA
AGAAGGTTCTGACGAGACCAGCAGAATTGCTGGGTGCCGCCTTGCAGAAGACAACCGCGGCATTATCGTCACCGTGCGCGTGCTGACGAACCATGCACAT
GCTGTATTCACAGCTGCGGGCGCGTTTGATGACGAAGACAGCGACGCAGATACTTCTCAAACTCCGGAGGCAAGCACACCTGCAAGCGACGCAGATGCTC
CTCAAAATCCAAAGCCAAGTACACGTTCAAGCGGCGCTGACGGTGGTGGTGTAGACAACAGTGCAGTATACAAGCTGATGGAGGAGTGGAAGACGAGTCC
GCAGGTGACTGACGGCCAAATCTGCTTTTACGACACGGACCGCGCTGACCCATCGCGTTACCGCTACTGCTTTGCTCTAGCCATGGGGCACTATCACTCG
GAAGAAGTGGAGGTGGTGCACAAGCCTACGCTGTGGGCCTTGCTTCACCCACCCAAGCCGAAGGTAATTTACACGCCGTACATGGGAGATAACCCGGCTC
TGCTTGAGCTGCTTGACCGCTGCATTGACACCTCTAAACGTCAAATCGGAATTCGGCCTCGAATTTGCAACCCGAACGAAGTACCCGTCCCACGCCCACC
CGTCAAGGACGAAGCCAAGGTAGACCCGCAGGTGCAGAAGGAAGAGGAAGGCCGTCAACTAGCTTGCGAAGCCCAGAAACGGCGAATGGCACAGCGCAAG
GAGCGCGAAAAGGAAGAGCGTGAAGCTCAAGCCAGCGGCGGCATCTTGGGTAAGCTGGATCGCCTCATTGGAAGCATCAAATCAGCAGTGGGGCTTGGAC
ATGTCGTGCCTGCAGATGAAAGTCTGGAAGATATTGAGTATGCGGACGTGTGCAGCCCAGCATCGTCGAAGAAAACAAAGCCTGAGGTGACGCTGAAGAG
CGCCCAGGCCCACTTATCCAGGGACACGTTTGGAGATTCGCTGCGCTTTGTAAACAAGCTGTATAACCGCGCGTTTGGCAAGCCCAAGACATCGGATCGA
CGTCGTGTGCCGTCCCACATGCCGTTCTTGCTGCAGAAGTCAATCATTAGCGAAATTAAGGATTACTGGACCAAGGAGGTGCAAGATACATCGGCTCACC
GCTTCCGCCACCCGGAGGACATGCAGTTCAGCTTCTCGTACTTCCACTACTTGATCAACCGCGTGAAGATCCATCCTCACACGCTTGAAGAGATCTGGCT
CGAGTACCTGGACGCAAACCGCAACGGAATCTTGGATGAGAATGAGGTATTGACCGCTGCGAGTCTTGCGCACGGAGACGCACCGCCTGAAGATTTTGTG
AACGAAGTCCGCGAGTGTGTGCAGCCTGAAAAGCGTGAGAAGGTGCGTGAGATCCCCACGGCAGAAGGCACTCTGCGACTCAGCGAGACGTTGACGCCAT
ACATTACGTTGGAGAATCTGGAGCGATGCCCGTCAGTGCGTGACGCTCTGATCAAAAACGTAAGGTACGAGACGAAGGTGGAGCTGATGCCGGAGACTGA
GGTGACGTTCCACATGCTGAGCGACAACTACAAGTTTGCCTGGAAGCAAATGATGGGCACACGTGCGCGGCGCACCAAGTTCGTCTGCATCAACGACGAC
ATGAAGAACCCGTCGACGGCGGTTAGTCAGATCCTGCACGAACTCTTCCTGTCGATCTGGCCGAAGCGGTCGCAGTTTGAGCTGCCGTATCACCTCAAGA
ACCGCTACGCGCACATCGACGAGTACCATGCCGCCCAGGAGCGTCGCCAGATTGCAGCCGCGATCGCAGCCTTCATCCTGCTGCTTATCGCCTTTGTCTT
CCGTGCCGAGCTTCGCGCAATGTTCGGGTTCCAGGACATCGCACGGGCTCGCGCTGCCTCGGCCTCGCAGCTCACACACGACTTCCAGCAAACGCAGGAC
GAGGAAGAGAACGTTGACGCTAAACTGGAGGCGCCTGCGAGTCCGACCTCGCCAAAGAACAAAACGAAGATGGCGTCGGCCTAG