Transcript Name :
Phyra_g12771
Orientation:
(-)
Number of Exons:
3
Description :
hypothetical protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Zinc finger, RING-type10.925PS50089
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-293
*** None ***
PositionContextScore
65AEAREKR|PW0.632
*** None ***
GO
Biological ProcessGO IDPrediction Method
protein bindingGO:0005515IEA
zinc ion bindingGO:0008270IEA
*** None ***
*** None ***
Sequence
        3034 bases(100 bases per row)
TGCCAATACACAGCGAATCGCGCGCTACTCCGCGCTCCGACGCCACAAACCAGGACGAACAACAAACGGCTGTACCCACTAGTGGCCTGTTCTTCTCTCT
GGAGAAGACGGAGAGCGACGAAGAGGAGGAAGAGCAGCAGGACCAAAGGTCGCTGGCCCGTACCCATGGACCAGCTGAGGCCAGAGAGAAGCGGCCGTGG
GGACGGAGAGCCGCCAGCAATGCTACAGAGGACGAGGAACAGGATCAGACGCTCCAGTCTGCAGCTCCAGCAATTAGACGGTGAGATTTAAAGTTGAGAG
TTGTGTCGAGTCCTTGTGTGGCTTACAATTGCTGTTATTTTTTGTATTTTTGTGAACGGAAGCCAATGGAGGCAGTGCAGTGGTCGCAGCAAGTGGAGAC
GATTTTGCAGAGGAGATCGAGAGTGAAGCTGCGGAGATCAGGACGCTGATTGCTCGCACGACGCAGCTTTGGTCGGCTGTGGACCGGGCAGAACGCGCGA
GGACGTTGCGCAGCCGCTGCAGCTGCAAGCATCGCGGAGCTTTTCGGCTTCTGCGCTGCAGACACGGAGGGCTTCGTTGCCTGCGCAGTATTTGTGTGCA
GAGAATGAAGACAGTACCCTGGGTAGCGAGGAGGAGTATGCAGAAGAGGACGACGACACGGAGACAGAGAGCGTCGGTGAGATGCCTCTTCAGCACATGA
ACCACGATGGAGGATACGCTACCGATGACGAACTGTTTGTAGCTCCATTGAGACATAGTCGTGGCACTCCTGTGCGTTCCCCTGGTCGTATGGTTGAACT
CAGAAGGTTAGAGCAAGGAGAGCTTGATGTACGAATAGCGACGGTGGTCATGAAAGCGAGGGATCGGAGGAGGAAGGATATGAAATGGAGCATACAACTG
GAGACTTGCAAGGCGAGCTCATGGACGCTTCGAACCGAGCCATCAACGCGTCGAAAGCTCGTGCCATCAAAAATGCGATGCTGGGAAACTTGATCCGGCT
TGGTTTTCGCGACAGTATCACTCGTGCAGCACTCGAGGCTGGCGTTCTTGAGATTGATCACTACGACTCTGACTGCGAGCTGGCATATGTTGACATCTTC
ATGTCGTTAGTGAAAATGGTGTGTGACGCCCATGTCGAAGTCGTGAATGAGAGTGATGATGCCGACCAAAGTTGGGTATCACCTGGAAGATCTTCCGACG
ATCATGATATAGCCGGCAGCTTGAATGCGAGTACTACCTATAGTTTGGAGCAGCGCTCTTTTCTCCCTTTCAAGTGGCCAGTCTTTGACATGGCGCAATT
TGAGTTTGGAAATGCACGCCCCGGAACATGCTTCAACAGTGTTTGTGTGCTGACAAATCTGCCGAAAGTGTCAATGGACCGCACGGAAGAGCTGATGGAA
GTTCTGTCGTGCAATTTGTTTTGCATGATTGGCGACCCTATTCAAGTGGTTATTCCATCGGCAAGTTCCACTGGACGTACAAAAGGACATGCCTTTCTTG
AATTTGACGACCCAGACATGGCTAAGAGCTGCGCTGCAGCAGTAGATGGGTTGACTTGGGGTAGGGGGCCCTTCGGCAGAATCAGAGGCAATTTGTTCCG
ACAGTATCAGGTAAAGTCTCCAGCGGAGGAACAGCGGCGTGCACCTGCAATGGTCGATGAGGCATCGTTTCGCCGTTCGTTTTCAGGCGCCCCAGTGTCC
GGATCCTTTCCGGGGGGCCTACTCCAGCCTATGAGCGTCATGGAAGTGGATTATCCAATCGATTTCGGCCTGGCATGGAGCAAAATGGCATATCCCAACA
ACAAAATTTGTTTTGTGAGAGCGATGAGGATAGCAGTGACGGGGGTGAGTGGGTTGTTGGTCGCCCGCTCGAGTATGCACCGTTTAACTCGTCGCCGCTG
CTAGATTTGTCTTCTGGCAGTGTGGATATCAGAGACCAGTACGCGCCTGGTCATCATGACGCAGTCGCACAGCAAGTTGACTGGGACGATGAAGCGTTGG
GTGGGGGATATGCTGTCCATTTATCAAGCGAGGAAGAAGATGGCATCGAGTACGACGAAAGCTTTGACAGCAATAGTGCGCTCGAGCTTCAGGCCCCCGA
TGAAGAGAAAGTGATGGACCCGTCGCTTTTTGATGAGCTCGTTCGAGAATGCAGGTATAGCGACTCGAGGTGCTCGCCAACTCGAGTATCGTTCTCGTCA
GGCGAAACACAAGCAGAATCATCGACCGTGACACCAACTGCATCTGCAGTTGCACGTGAAACACTTGCTGATTGTGGTATGGTAGAGCAGCCCTGGGATG
CATCGCATGAAGTCGAAAATGGTGCGGAAAAGCCCTGGCGTCGATATTGTGAGGAACTGATTGTCCGCAATCGAGAAATGCAAGATCAGGTCGCATTTGC
ACGTCGTCGCATTGCCCAACTGAGCCACAACAACCAGAAGTTGCACTTGCTGATCGATCGGGTGGAACGGGATCGCGATGGGTTGCTATTTGAGAACGAC
TTGCTGCAGACGCAACTGCACGGATACGAGGATCACGAGCAAGATCAAGTCTCAATGATGAAGGAGCTGGTTATGCTGCGCAAGCGCCTAAATCAGAAGG
AGCACTCGATCGATTCAAGGAGCCTGGATCAGCATCACCACTTGCAGGCTGCTTACGTAAGTGCAAGCCTCTTAAACCCCTCAAGTTTACTTCATGGTGT
TCGATCGGCACTTTCCCATCTTTCAGCGTCAACGCTTGCGAACTGTAAGATGGAGGAGCTCAAGGAGTGGGAGCAACTGCTGGAAAGTACGTTGAGCCAT
GTGCGCTCAGTCAAGGAGGAAAAGGCACTGGAAATGCAAAAGAAGCTGGATCGCCAGGTCGAGGAGCAAAACGAGCTCAAGCTCTGCGTTATCTGCCTGT
CGAACGAAAAGAGCATTTTGTGTTTGCCGTGCCGGCACTTGTGCTTGTGCAAGACCTGCTCCTCCCGTCAAGAAGTCACCAAGTGCCCCATTTGCCGCCT
AGAAATTGAGGAGATGCTAGCTGTGTACTCCTAA