Transcript Name :
Phyra_g1193
Orientation:
(+)
Number of Exons:
4
Description :
hypothetical protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-260
*** None ***
PositionContextScore
12GANRTFR|SI0.657
193CNERKKR|ND0.683
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        7314 bases(100 bases per row)
ATGACTGGAGAAGCCGGCGCCAACCGCACGTTCCGCTCCATCTTCGGCGACCAGGAGCAGCGGCACGACGAGGTGCATAAGCTGGAGCTGGGGCAGAGCG
TCAGCAGCAGACCCGTCGTCACCGACTCGGGTGCTGGACTGGCCATGGACGACGACGACGAAGCCATGTGGAGTGACGAGCCGCCGCTGGGCGATGCAAT
AGCTCAGGATAACAACGACCTGCCGGGGCTCCAGTTCGCGGTGCGTTGTTGGTTGTTGCGAAACGGCTAGGGAGTGCCAACCTTTGAATTGACTTTTGGT
GTTTTTGCTTGCGATTCTCAGCAACGCAAGTCCATGGAAGAGTGGGCAGAGGATGATGACGAAGAGGAAAACTGGAAGGATGCACTGCAAGACCGCGTCA
ACCAGCTGGAGCTTGCGTTCCAACACAACAATGACACCGCTGCAGCAGACTCCCGGCGTCGCTTCGAGCAGCAGCAACTGCTGCAGTTTTCAGCGCCTGA
GACGCATCACATCAACTTTGGCCAGACTCTCCCGGTCTCAGCGCGCTTCACCACGACGAACTTGGGCTCGGAGCGCTTGCGACCAGCTAGTCGCCATAAG
ATGCAGCGCACATCCTCGTCGCATGCATGCATCACTGGCGAGGCTGCCGTTCAAACTGCGTCTGGACGCTCAAACCACCTCTGGAATTTCCAACGCAAGG
TAGCGGGAGGGACCACACCGACTCCGATCGCTCAAGATGCACGCAAGCGGTCAACCTCCATAGATTTCGTGGCCCGCAACATTCAGACAGTCGAGCACCA
TCGCAAGCGCTCCGGTTCTTTGAGTGGGGCATCCAGCAGGACCGATTCGCCTCGACATTCTCAGTCCCGGAAGAATTCCTTGGACAGTAATCACAGCAGC
CTCGGCCGAAGTAATAGTAGTAGTCTCCACGGGAACACGGCAGCTGCACCAGCCGACAGCACATCATCAGGCGCGGCGGTATTTAACCTGAGCGACACGG
AAGCCATTCGCCGTTTTGTGCTCGACGACGTCAAAACGGTAAGTCACCCCTCTCTGTCTTGGAACGCTTGAGGCTGCGCTCTGACATTGTGCTCTGCTGT
GAATAATGCAGATGTCCATGGAGCGACTGGTAGGCGACGCCCAGCGCTTACATTTTTTAGAGGATTTCTACCAGAATCACCACGCACCAGGCCCCGGGCC
GGCCGCCGCGGCGCCACCGTCGCCTTCCCCCTCCTCAGCTATGTCCACGTCCTGACCGCACTCTGTTCTATTACATTCCTTTGCCTTGCCTTGCTGTTCG
GATGCGATATTTTGCTGCATGCTCTATTTAACGACATTTTAATCTTTGCTGCAACGCACGCCATGTGCGTCTTCATCTCGTTTCTTGGTTTGTGTTATGC
TTCATTCCTCTGCGCAGCATCTAACTACGCTACGTGCAGGCTGCACTGCAGCCTTGGGCTTGGTCACGCCACCTGGGCGCTGACTGAAATCGAAGGAAGC
AGCGACCTCAATCGCCCGTACGATTTGGATGCAGCAAGAATCCTTCTCTATACACGGGCAGCGAGGTGTATTCACCTCCAATCTTTCGATCACAAAGCCG
ATTGATTCATCTACGACAGCTCGGAGGTGACCTCCGCCATCAACCTCCGATACACCGGCCCCTCCTTCTAGTTGGAGGTATGGGTAATGCTGACATCTTA
GCTTCGCGTTCTTTTTGACGGACGTGGAGATCACTAACGCGTAACATGCTGACCTGTGTATTGCTTCCCAGGCTCGAATGCTCCTCGAAGGCGCTCTCGC
TGTAGAGAAGACAATCAGATTTGCGTCGGCTTGAGAATTACTGCGATGATGTGGAGAGTGGCCAGTTCTCATACGAGAATACTCTCTGTGTAACCACGAT
ATGCATGAAATGTAATGTGACTAGAGCTGTCGTGGTTAACTAACCTCACCTCTAATCGACCCACACCTCTACCTCTGGCCTAACCTCTATATCTGTGGCC
CACACATTATTATCATACAAAACCCAAGTATAAACTAGTGTTGGCGAACACAAAGAACCCCGTCCGCAACGACATTGGCGAGATCAAGCTACTGGAGGCT
AAGAGCAAGGAGGATGTCAAGCAAACCAACGAGCTGCCCAAGGGGATGAAGGCGCTGTAGCACAGCGACAAAATGATGGCGCAGTCGATGGCCTTGAGCG
GCTGCAGCGAGACCAACTACCGTACCGTACAATCTCCAGACGTGCCAGAGGAAGTTCCTCCACGACATGCATATCTTCATGCAGCTCTGCTCCAAGGTAC
AGGGGAACTGTCGTACCGACGAGAGCGACGAGTTTGGAAATGCGCAGTGAAGAGACATTCAACTTCGTTGCGGCGGCACTTTAGTAACGCGTATTGACTT
GACCAAGTATTTCTCCACTATGGCTAAGTCATCGTCTTCCTACATCTTCCTATCGTGAATCAACACACTCACACCGCCGTAATCGATCAAGGAACCCCAT
GCATGCCTTGCCTATCGGGTGAGAGCTCACCTGTTTCGGTTGCCTTCGTCATGCATCCCTGTGAGTTGAGGTCATCCGTGAATATGAATTCGAACGCAGT
GCTTGTTCGAAGCAGATCCTCTTGCTCGACATCGGCACGACTTGCTTGCTATCAAGGCGGTATTGATGCCAATAAGGACCGAAGACATGTAGGGCACAAG
TGTTGTGAAAATGACTCATGTAGTCCGTTTCCGAATCACGAAAGCAATCGTCATATTACACCGCTTTCAATACACGTAGAGTGACCGTTGTCAAACTCTT
CGTCGGAGATACCAGTAGTTCGGATGAGGAAGCATTTGAACAAATAACCACAGTTGATACTTGTGCTGGCGTCGTGCCGTAAATAACCGCGTGGATCACT
ATGAAGCCGTGTCCCGGGCTTAGGAATGCTCCAGAAGCGTACAGCTAGGTCTAATTTCGGATCGCGTTTGGGTGCGGCTGCAACCTCCTGAAGAGTGGCT
GTGGGTCTACTGCTTGATGCGCTGGCAATGACGACATCACTTGCACCTGTTACTGTTTCTTTAGCTGACAAGGTGAAGAACAGGACTGAGGATGCCGCTG
TCGTGTAGGAACACGTCCAAAATATGTATGCACACTCCCACCACCAACACCCACCAAATCCACGAGGATTCAATGAGCTTTGTCGGGCAAATAGAACCTG
GAGGCCCTAGTTCTCGCCCTTACACCGGATTGGATGTTTCCTCTGCGTACTGTGGTTTCCGTAGGCTAATAACCAATATCCAGCACCACTAGCCACGAGC
GACGGCTAGGATGCTCTTCTCACACTGAAACCTCGTTGTCCCTCAGAAAGGAAGGGTACGAGCCGGTCAAGGTCTTGTACGAGGTGCCGGGGCTTAACTC
CGGCGGGAAGAATATATGGGACGCACTCAGGCGTTCCCAAGTGCCAACGAGTTCTCGTTGGTCTTCTATCACACGCACGGCCACTCTCTCTCTCTTCTCT
TGGCCTACCAGATAAACACTAGCCCACACAAACTACGTGTTCACCAACATACAGTTCCTACCCTACCGAGCGGGACCAGACGCTCCGGACACTTACCGAA
GCCGGACTTGACTCTTGAGTGGTTGAGAGGAAAATATGTTCTGTTTGTTGTTGCCCAGTGGCCATTCCTAATGCTATGCTTTCCTATGGTTCCTATACAA
ATATCTAGTGTAAACGAGTCCGTTACGGATCTTCTCCGTAACCTACGAGGACTCCACCGTCGCCGACGCTTCGGAACAGTCGAACGACGACTCGGACTGG
TCGTTGGTTTTGGACCTTGCCTCTAAATACGCTCTGCGCATCTAAGTACGGAATCTCGCCCACTAAGTTCGGTTCACGTACTTAGCTGTTCGCTGATCAC
CATTCCTCGCCATGTCCAATTTGTGGCCAATGAGCGAGCGGAGAAGCCTTTTATCAGTTTGACGAGGTTTCCCAAGTCATTCTTCGCAGCAACGCCAGCT
TCCAACGGCAGGACCCACGCTGCGGTGAATTCCTACACCACACCGCTGTCGTTTGCTCTGAGAGGTTAGCGTATTGGGGGCTGCACCGTAATTGTTAGCT
TGAGGTGTTCTGGAACGGCTGCGTAGCGGGTAGCGACCAGAGGTCGGAGGCAGACTTGAAGATCCAGACGAATCTCCCAGGCGCAGCCTAGGCTCCGAAC
GAAATCCTAGAGTTGAACTGGCCTTTATAGAGCTACTGCGGCTGATGCTGCCGTGCATGGGCGAAGACGCTCCGGTGTGCAGAGAGGTGAGCGCGACATC
CGACCGGAGCTCTTCCATTGTCTTCGATCGCGATTCTATTGCTTGTAGCCTTGAACTCAAGGATCCAAACTATGTTTACTTGGATTTGTATGGGTGTTAG
CTAGAGGTTAACGCAGGCTTGGAGATCCGTGCAGGTTGTTCGAAAAGTAGTTGTTAAGCAAGTTAAGCTTAACTATGGCGACAGCTCTAAATGTGACAGG
TAATCTAACTAAATTGGTGTACAAATGCTGAGGATAGATGTTCAAATAAGAAACCCAGAAGCTGCACGACATGGTTGCCAACGACTACAGCCACAAAAGC
AGCAATGATGTTGGTGAAGACGATATTCCGACTTCGAGGTGGGTTATACTGACGGGGGCGGCAACTAGTGCCGCAGTCCACCTGCATGTGCGTACGCCAT
TCATCCCATTGAGCCGTAATTCAATTACTTTTTAGCAGCAAACGAGGCTTTCCAATTCACACAGAACAAAACTCAAGTCCGCATGCTCCAGCCTTCAGAC
TGTTTAAATCCGTGGCAGATCAAGTTGAGAAGAACAAAACAACGATTTCCCATTGCTGGTTTCAATAAAATTCATTGCCACTACTTTACGATACAGCGTA
AAGTGCAAACATGTCTTCAGGCTGACCTAAACTGAATAGTAAACCTGGTCACTTGTTCATCAGGGTGGCTTGTCAGGGAATGAGTTAATTTTGTCGTCAT
CAAGCAGCATGTCACGATATGCGAGCGAAATCCAGGCACGAAGAAAGCCTCGGACGCAAGCACTGCAGCAGAGTAGAAGAGCAAGCGAGTGAACGATCAA
AGTGATCAACCGGGAGTAATGAGCCCCTGTCGACCACTGCAAAAGCACATCATCACTCGTAGCACACCTGCATCTATAGCTTCAACGAGGGTAATGAGCC
CCGGTCTACTGAGCCTGCTGGTGCAACTTCGAGTAAGGCCTACAAAGCCCTAGCCCTCCACGTCTAAAAACCTCCAGAATATTGAGCGACATAGAGAAAT
GAGTCTGTGACTCACCAAACGGTAGATCTAGTAATGAGTCCCATACCGCGCAACTTCCATATCATATTCCCTCGATAAAAGGGAGACATGAGTGTCCCTC
AACGCCACGCCAGCAATTCCCACAACTTGTCACCAATCAAAATCTTCTGCCATCTGGCAGCAGCAGCCATCCGCCATACAGGGGCCCTAGTTCAGGTTTC
GTCGAGGACGATTAAGCTGCTGAATGCAGATAAATCTTCGGCGATGACGATGTGGGCGTTGCCACCGCACACGATCCCCGTGTTTGACTCTTGCAGCATG
TCCAAATCGACTTCACATCAGCCGCAGCTCTTTGATATGATCATGGTGGACATGCAACCCCATGGGCTTTTCACCAGCGTCAAAAGCGACGATGACGAAA
TCTTGCTCGTGGTTCTGGAGCTCGCTGTACTCTCTCCGCTCAGCTTGACTTTCTTCAGTTTCACCATTGTCTCGGTCTGGCCCACCTCCCACTTCCGGGA
CTTGCGCGCCGGTGTCTTGTGCGTCTCACGGTGTTGCTTGGCTTTGGTCTTGGTGCCTCGCGAGTTTCTCCGTAGCCTTCATGTTCGTTCGGCGAGCCCT
CAAGAGGAAGACACTGAGTCCTGTGGTCTCTTTGGACAGCGCATGCTCACTGTCCGCAGCCTTACGTTTGACCTTCTCAGTCTTTGCTTCGTACATGGTC
CGAAGCTGCTCCACCACTCAGCATTTCTGCTGCTGAACAACCTGCTCACGACATTGGCGCAGATCCACGGCCAGCTCCATGTTGCACAGCTCCATTATGT
CAATGTCCGGCTTCAACTTCTTCACATTCCGCAAGTACCAACTTGCCTGGATCAGCGCCTGCTCCCTGTCCGCGGCCACTTGGAGGGGTTCAGCGAGTTC
ACGCTCTACCTTGGGCACTTTGACCCCACCTTGCCCTTCAACAACCCCTCAATGACGTTCGCCTCTTCCGTATCGGTCACACTGCTGTAGGCCTGGTACT
TATTGATGGGGCCGCTGACGGATCCGCTCTTCTGCGGTTAGGATCCTATCCCGCGCGCGCACGTCCCACGAATAGCAGTAATGATACAGGCATGGTACGG
ACACTACTACTTGGACGAGCGGCCTTCAAGGAAGCCCAAATTGGCATCGCATAACTCCTTGGCTGATGGGGGATATAACTAGCACTATTTTAGGAGGCTA
ATGATACTGTAACAGGGCTGCTATTGAAGCGCCCGATGGCACATGCAATGACGGACGAAATGGACGGAATGGACGGAAGGTGGACGGATGGATGATGGAC
GGATGGCGGTCCGGCGGATCCTTGCGAATGAGCGGCTGGCGTGACGGCAAGGGAACTGAGCGAGTACCTCCGGCGAGCAGCCGGCACGCAAGTGAGCCTC
GAGTCGAGTGGCTGGGCGGATGATGGCTGGACGGAGCCCCTCTGTGAGGGCTCACTTTGGAAACGGCGCTGAAGAGTGCAAGTGGTCGTAAAGGACTGCG
AATTGGACGGACGGGCGGCCAAGCGAGCTGCTGGTAGCAATTTGTGCACAGGCGGTGCAGCTAGTCGTAGTTGATTGCATTGGCAGGAGACTAAATAAAG
TAGGTCGTGTGTCAGTGACGCACACACCGGCGCAGTGGATCTGAGTTGTCCACTGACGGTCAGACGGACTTTGGCGCAAATCGGCACCGTGTCGACCAAC
CCCGGCGTGCAGGGGATCATTAAGACACGTTGCATGGTGGTCATAGAGGGGCGTAGTTTGACGAAGATCTACGCACAGTTTGGTAATTTCTGCAACGAAC
GGAAGAAGCGCAATGACGAGGACTCCAGCGACTTTTCCCGGAGTGATCACGCGCTCTCATGGACCAGCGACGGTTCCCCCGGCGCCTACGCCGAGAGCTT
CGCAAACGGCTACCTCTACGGCGTACACGACGACGACGGCGGCAAGCGCAATGACGACAACGACGCCTTCAGCGACGGCAGGCACTACGGATGCAGCAGA
ACCTCCAGCGAGTA