Transcript Name :
Phyra_g14100
Orientation:
(+)
Number of Exons:
3
Description :
XP_009525441.1 hypothetical protein PHYSODRAFT_360288 [Phytophthora sojae
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-214
215-237
238-269
270-289
290-308
309-328
329-342
343-365
366-369
370-392
393-425
426-448
449-462
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        4250 bases(100 bases per row)
ATGTCCAGGAAGCACTCGCAGCAGTACACGGTGGTGCTCAACGGCCTGCCGCCGAACCTCTGCACGCAGCAGACACTACGCAACTACCTAGAGCTGTTCT
TCCCCAAGGCCGTGCTGCACGTGTACGTTGCACTAGAGTGTCGGGACCTGGAGAAACTCGTGGTAGAACGCGTCAAAGTGCGCAACAAACTCGAGCACGT
TCTGGCGCAAAGTGCGTTGACCGGAGAGTGAGTCATGACGTGAAATAAGCTGCTGGGAGGAGAGAAGATGGATGCCGCGGAACTGTACCAACACCAGCTC
AAGGAGCTCAACATGGAGCTCCGATCCATTATGCGCAACCAGGCTGCGGTTGCGCGTCAGTTGGTGGAGTCCAGCGGAGATGACGAGACCTACGGATTTA
ACCAGAACAACATGGACTCGGCCAGGAGCATCAACTTTGCGTACAAGGAGGAGGAATTGGACAGCGATGCGATGGAATCGAGGTACATCAAGAGTTTGAA
GGGACAGGACAAGAAGGCGGTCGGAATCATGCGTGGAGCTGGATTTGTGACCTTCCGCAGCGTGAAGGTGGCACAGTCCTGCACTCAGATCTTGCAGAGC
GCCAACCCCACGCAAATGCACGTGGAGCCTGCAGCTCACTCTGAGGATGTGGTGTGGGCGAACATCGGACTGTCCAAGAACATCAAGGACACGTGGTTCC
TGATCTCTATGGGGCTCAGCACTGCGATTATCTTGCTCTGGACGGTGCCTACAGGTATCGTTGTGTCTTTTGCCAAGGTTTCATCGCTGGAGCAGAATTG
GGCGTGGCTTGTCCAGGCCATTCGAGATCACCCGTGGGTGGAATCGGTGCTGGAGCAGGTGTCACCGTTGATGCTGTCCGTCATGACGGCTTTGGCTCCG
ATCATCTTCGGCATCCTGTCCAAGCGCGAGGGTCATGCATTTGATTCGCAGGTGAACGCGTCGCTGTTGAACAAGCTGGTGATCTACCAGATCTACGTGA
CGTTCTTGCTGCCTATTTTCGGTGGTACCGTCATCGATGCAGTCATGGGCTCGGGTGACACGGATCTGACGGATGTGAGCGCCGTCCTTACCATTATCAG
TGATGCAGTGGCGGTGCAGTCGGCCTTCTTTATCACTTATCTGCTAGTCAGAACGGGACTCAATTTGACGTTGATCTTGCTGCGCGTTACGCCAATCGTC
AAGGCTGCTATCTACCCAGTGTTCGTGCCCAAGCTGACACCTCGTGAGCGCGCATCGGCGTGGTTTGGCCTTAACTCACTGGCTCACCCTGGCGATTTTA
GCGCTTCGGACCCAGTCTCCGAGTATTTCCTGGTGCTGATGCTTGTACTGGTGTTCTGCGGTATCGCCCCTATCCTCAGCTACTTCGCGCTCCTATACCT
GGTGCTATCGGACTTTGTGTATCGTTGGGCGGTCATGCTCCATCAACGCAGACGTCTGGCACGTACTCCCGTCTCTATACCGCTATATCGTTGATGCCCT
CCTGTTCGCACAGATCATCTTGGCGTCCGTGTTGGCCACCAGTATCGAAGCTTGGTGCCGCCGGTGCAGATCAGCGTGGTCAAAATGGGTACTGCTTACC
CAAAACCGCTGCTGGCCGGTCGGTGGCCAGCCCACACCATGGCGACGACAGAGTGCGTTTTGGCATCGCATCTACTTTATATACACTCCGTACAATGACG
TGAGCAAGCGCGCAGCACGCAGCGTGCCGGTGGCATTGCTTTGGTGCCGCCGGTGCTGATCAGCGTGGTCAAAATGGGTACTGCTTACCCAAAACCGCTG
CTGGCCGGTCGGTGGCCAGCCCACACCATGGCGACGACAGAGTGCGTTTTGGCATCGCATCTACTTTATATACACTCCGTACAATGACGTGAGCAAGCGC
GCAGCACGCAGCGTGCCGGTGGCATTGCTTTGGTGCCGCCGGTGCTGATCAGCGTGGTCAAAATGGGTACTGCTTACCCAAAACCGCTGCTGGCCGGTCG
GTGGCCAGCCCACACCATGGCGACGACAGAGTGCGTTTTGGCATCGCATCTACTTTATATACACTCCGTACAATGACGTGAGCAAGCGCGCAGCACGCAG
CGTGCCGGTGGCATTGCTTTGGTGCCGCCGGTGCTGATCAGCGTGGTCAAAATGGGTACTGCTTACCCAAAACCGCTGCTGGCCGGTCGGTGGCCAGCCC
ACACCATGGCGACGACAGAGTGCGTTTTGGTATCGCATCTACTTTATATACACTCCGTACAATGACGTGAGCAAGCGCGCAGCACGCAGCGTGCCGGTGG
CATTGCTTTGGTGCCGCCGGTGCTGATCAGCGTGGTCAAAATGGGTACTGCTTACCCAAAACCGCTGCTGGCCGGTCGGTGGCCAGCCCACACCATGGCG
ACGACAGAGTGCGTTTTGGCATCGCATCTACTTTATATACACTCCGTACAATGACGTGAGCAAGCGCGCAGCACGCAGCGTGCCGGTGGCATTGCTTTGG
TGCCGCCGGTGCTGATCAGCGTGGTCAAAATGGGTACTGCTTACCCAAAACCGCTGCTGGCCGGTCGGTGGCCAGCCCACACCATGGCGACGACAGAGTG
CGTTTTGGCATCGCATCTACTTTATATACACTCCGTACAATGACGTGAGCAAGCGCGCAGCACGCAGCGTGCCGGTGGCATTGCTTTGGTGCCGCCGGTG
CTGATCAGCGTGGTCAAAATGGGTACTGCTTACCCAAAACCGCTGCTGGCCGGTCGGTGGCCAGCCCACACCATGGCGACGACAGAGTGCGTTTTGGTAT
CGCATCTACTTTATATACACTCCGTACAATGACGTGAGCAAGCGCGCAGCACGCAGCGTGCCGGTGGCATTGCTTTGGTGCCGCCGGTGCTGATCAGCGT
GGTCAAAATGGGTACTGCTTACCCAAAACCGCTGCTGGCCGGTCGGTGGCCAGCCCACACCATGGCGACGACAGAGTGCGTTTTGGCATCGCATCTACTT
TATATACACTCCGTACAATGACGTGAGCAAGCGCGCAGCACGCAGCGTGCCGGTGGCATTGCTTTGGTGCCGCCGGTGCTGATCAGCGTGGTCAAAATGG
GTACTGCTTACCCAAAACCGCTGCTGGCCGGTCGGTGGCCAGCCCACACCATGGCGACGACAGAGTGCGTTTTGGCATCGCATCTACTTTATATACACTC
CGTACAATGACGTGAGCAAGCGCGCAGCACGCAGCGTGCCGGTGGCATTGCTTTGGTGCCGCCGGTGCTGATCAGCGTGGTCAAAATGGGTACTGCTTAC
CCAAAACCGCTGCTGGCCGGTCGGTGGCCAGCCCACACCATGGCGACGACAGAGTGCGTTTTGGCATCGCATCTACTTTATATACACTCCGTACAATGAC
GTGAGCAAGCGCGCAGCACGCAGCGTGCCGGTGGCATTGCTTTGGTGCCGCCGGTGCTGATCAGCGTGGTCAAAATGGGTACTGCTTACCCAAAACCGCT
GCTGGCCGGTCGGTGGCCAGCCCACACCATGGCGACGACAGAGTGCGTTTTGGCATCGCATCTACTTTATATACACTCCGTACAATGACGTGAGCAAGCG
CGCAGCACGCAGCGTGCCGGTGGCATTGCTTTGGTGCCGCCGGTGCTGATCAGCGTGGTCAAAATGGGTACTGCTTACCCAAAGGCCAGCCTTTTACAAC
TAGGAGAGAGAAGAATACGGTGGATCTTCGTACAAGCATTGTCAGATAAGGTGATGAAAGCGTTACCACATTGTGGCAACGTTAGTGTGGTTGAGTTCAC
TGGCGATAAAGGTTATAGCGATCAACTGGATGTTTAGGCAAGATGATTAACTTCTCATGCAACTTTGCAGCTCGTTGCCCAGCACCGGTTTAATGTAGTT
CAGAATTTCAACCTAAGTTAAGGTGTTGTTATCACGACAAGCTAAACGTGAAGGTGCATAACACATTTTGAAAGTGCTTGAAATTGCTGAATGGTGCTCA
ATTATTTTGTATTACTCCCTCCGTTTCACAATAGTTGACTTCAAGTGGGCAAGTCAGTGTTTCATATTAGTTGACAGTTTCTGTGATTGGTGGAAAGCCA
ATTGTGTTTGGCCAGTCACTGCGTACAGCTGCTGAGGTTTCTGTGTGGGTGCTGTTTTAATGCGGGTAGTCGGCAGGTTTAGCATAAAATTACTGCGGGT
AGGCAGCGGTTTTTACTGAACCTACCGTCTTACCCCGCATAGAGCGCATG