Transcript Name :
Phypl_g1704
Orientation:
(-)
Number of Exons:
1
Description :
arginyl-tRNA synthetase, putative
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
fprintscan predictionP-Valprediction_id
Arginyl-tRNA synthetase, class Ia, core1.4PR01038
Arginyl-tRNA synthetase, class Ia, core1.4PR01038
Arginyl-tRNA synthetase, class Ia, core1.4PR01038
Arginyl-tRNA synthetase, class Ia, core1.4PR01038
*** None ***
HmmSmart predictionP-Valprediction_id
Arginyl tRNA synthetase N-terminal domain4.7SM01016
DALR anticodon binding2.5SM00836
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-815
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
ATP bindingGO:0005524IEA
nucleotide bindingGO:0000166IEA
arginine-tRNA ligase activityGO:0004814IEA
cytoplasmGO:0005737IEA
arginyl-tRNA aminoacylationGO:0006420IEA
KO ID
K01887
*** None ***
Sequence
        2448 bases(100 bases per row)
ATGCAGCTCCTGATCGGCAAGAAGccgggcgacgaggagctcaagtgCTTCCTGGCACTGTCGCTCACCGGCGCCGCGTTCTCTGTGGGCGCCGCGGACA
AGAAGTACTCGAGCTGTGGCCCCCAACTGCTCGTCAcgcccgacgccgagctgctcttctcggccaACGCCGTGTGCcgcttcgtggccgccagcgccga
ccagctgcagagcgacgacCTGGCCGTGGACGAGTGGCTCGAGTGGGAGGCCAACACGCTGGCCCCGTggctgcgcgtggccaaggccgccaGAAACAAG
AGCGGCCAGCTGGCCGGCCAGCTGGCCGCCATgctcgaggccaaggaggaggcgagCCCCAAGAACAGCGGCGACCTGCAGTTCCTCTTCGGCCCGGAGC
TCTCGctcgccgacgtcgtggccgGCGTCACGCTGCGCGCTGCCTtcaaggtggtgaaggaggagaaggacgaggccgccgtgCTCCAGACCTTCCGCAA
GTACGCGGCCCAGCTCTTCGCGCGCGAGGACATCGCCAAGGGCGTGGCCAACATGAAGAACGCCGGCAAGGCCCCCAAGAAGGGCAAGGGCGCCCCCGGT
GGCGCCTCCGGTGcccccgctgctgccgtcaAGGACGTCAAGCGCTCCACgttcaagctggacgagaagctcgagcaagGGCTGACGTACCACAACGTCC
TGGAGGTGGTAGAGTCCATCTTCGACGCTGCCATCAAGGCTGCGTACCCGGGCCTGGACATCCCGCCCGTCGAGGTCACGCGCACCAACGTTAAGAACGC
CAAGTTCGGCGACTACCAGTGCAACTCCGCCATGTCCATCTTCACGGCGCTCAAGGGCACGCCGAACGCCGCCGGCTCGCCGCGTGACGTCGCCAACACG
ATCATCGCTGCCATGCCCGAgacgcgcgtgctggaccgcCTCAGCATTGCTGGCGCGGGCTTCATCAACGCCTTCCTGACCAAGGCGTTCGTGGCCGCGC
GCTTGTCGAACGTGCTGGCGAACGGCGTGCAGCCGGCCccgcagaagaagcagacgaTCGTCGTCGACTTTTCATCGCCGAACACTGCCAAGGACATGCA
CGTGGGCCACCTGCGTTCCACGATCATCGGTGACACGATGGCCCGCATTCTCGAGTTCCAGGGCTACGACGTCAAGCGTATTAACCACGTCGGCGACTGG
GGCACCCAGTTCGGCATGCTGATTTGCCACCTCACGGAGACGTACCCGAACTGGGAGACGGAGATGCCCAACGTGACGGACCTGACGAAGCTATAcaagg
ccgccaaggagcGCTTCGATGCCGACGAGGACTTCCACGAGCGCTCCAAGGCgcaggtggtgctgctgcagtccggCGACGAGAATTCCCGCAAGGTCTG
GGTGACGCTGTGTGAGATCAGTCGCCGCGAGTTCCAGAAGGTGTACGACCGCCTGGGCGTGTCACTCAATGAAATGGGCGAGTCGTTCTACAACCCGATC
ATCCCGGACGTCCTGGACCAGCTGCGTGCCAAGGGCCTCGTCGAAAAGAGCAACGGCGCCGAGGTGGTGTTCACCAAGGCGTTCAAGCAGCCGTTCATGC
TCGTCAAGAGCGACGGCTCGTACCTGTACGACACGACGGATATTGCTGCTCTGTGGTATCGCCTGCACGAGATGAAGGCCGACCGCGTTATCTACTACAC
GGACTACACGCAGAAGGATCACTTCAGCCTGCTCTTCGAGGTGGGCCGCATGTCGGGCATCTACGACCcgaccaagcagcgcgcggatcACGTGGGCTTC
GGCACGGTGAACGACGAGTCGggcaagcgcttcaagaCGCGCTCGGGCGAGACCGTGCgcctggtggagctgctggacgaggccaaggtgcGCATGaagg
cgcagctggtggagcgtATCGAGGGTGGAcagacgtcgctgcccatGGACCAggtggacgctgctgccgagaAGCTCGGCTACGGCGCCGTCAAGTACTT
CGACCTGCGCCAGAGCCCGACGTCCAACTacatcttcagcttcgaccGCATGCTGTCCACCAACGGCGACACGGCTGTGTACCTCATGTTTGCGTACGCC
CGTCTGTCCTCGATCATCCGCAAGTCGGGCGTCGACATGGCtgcgctcgtggcgcagcagcagaaggagggcAACATACTCAAGCCGGAGCACCCCACGG
AGCAGGCTCTggtcatcgagctgctgcagctgcaggacgtgaTCGTGTTCATTAACAAGGACCTGAGCTCCAACCGGCTGTGCAGCTACCTGTACACGAT
CTCGGAGAAGGTGCAGACGTTCGTCACGGCGTGCCGAGTGCTTGGTAGCGAGGAGCAGAGCAgccgtctgctgctgtgcgacgCCACGCTCAAGGTCATG
AAGACGTGCTTCTCACTGCTGGGCATCGACCCGCTGGACCAGATCTAA