Transcript Name :
Phyra_g19
Orientation:
(+)
Number of Exons:
4
Description :
hypothetical protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
fprintscan predictionP-Valprediction_id
G10 protein6.4e-31PR00322
G10 protein6.4e-31PR00322
G10 protein6.4e-31PR00322
G10 protein6.4e-31PR00322
G10 protein6.4e-31PR00322
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-516
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
nucleusGO:0005634IEA
*** None ***
*** None ***
Sequence
        5986 bases(100 bases per row)
ATGAGTACAAGTGCAGACACGAAGAAAGAGACGAAGGAAGAGAAGAAGGCCGCTCACCCACCGTTCGATGGCAAGGACTTCGAGGTGTGGTTCGAGCGCA
TGAAGTTGAAGCTGGAACGCAAGGGAATGTGGAAGTACTGCGTGAAGGAGATCGAGGAGCCGGAGGAGTCGAAGCAGAACGAGCACGACGCGTGGATGAA
GGATTCTGCGCGCGCTAAGGAGCTACTCTATGACGGAATGACGGACAAGATAATGAAAACGGTGAAGTTTGAGCCGACTGCGTTCCGTGTAGTGGAGAGA
CTGAAGCAGAGATTCGTCGGGAAAACGTATTTCAAGTATGCAGCGGAGATGACACAGCTGAGGAAGCTCCGACTCCAGGAGAACGGGAATATGCCCGATC
ATTTGGGTGAAGTGCGAAGATTAATTGATCGAATTGCTCTATTGGGTAAACCTCTTGATGAGTATGAGAAGCCTGCGATTTTGATCGGCACACTGCCTGA
CGATTACGATAACGTGGTGGAAACATTTCTGGCAAGTCACGTGCCTCGAGATGTAAATGACCCTCCCAACTATGATCAATTGGAGCATGCATTGGAGCTC
GCGTATGATCGGCGCCAAGGACGAAAGCTAAATGAAGGCAACGAAGATCAAGCCTTGTTTGGAGGATCTGGTAGAGGTCGGGGCCGAGGTCGTGGTCGCG
GTCGTGGCTCTGATCGTGGCCGCGGTGGCCGGCAGTGGAGGACGTGGCCGAGGCAGAGGTTTTGGTCGTGGTGGTGGTCGAGGAGGTAGCCAAGGAGCTG
GACGCGGACGTGAAGGTCAAGTCACCAGTAAAGGAAGATGTTTTCATTGCGGAGAGCAATCGCACCAAGTGCGAGACTGCCCGCACTTACCGCCAAGTGG
TGCCCGCGGATCCGAGCCACCTCAAAAGCAAGCCAAGGTAGAAGGAGCGCAGGGGAAGCGAGCTGCAAAGAACCAGTATACTCAGGATGAGAGTGATGAA
TCGGCATATGTGGTTAGTGCTCTCATTAAGCAGCCTCCCAACGTGCAGAAGTTTGCAAGCAAGCGCTGGTACTTGGACTCGGGAGCCACAAGCCATTTGA
CTAACCAGAAAATTGATTTTATTTCGTTCACGGCCATGAGTGCATTGGTGAGAGTTGGTGGTGAGAACTGGTTGAGTGTAGCTGGAATTGGCACCGTGAA
AAAGGAGATCCAGACTACGAGTGGGTGGCGGACGTTAGTACTGCGTGGAGTACGCTATGTACCAGAACTGCAATGTAGTTTGTTCTCAGTGCGGCGACAA
ACCGCACAAACCCTGCCCGCAGATGAGAAGGTTCGAGTTCACTTTGATGACGATGAATTCGCAAAGGTGAAATTTGAACAAGGAAGTGCGAAGGCACATG
TCGACAGAACCAATCTTTATTGCTTAGAGCTGGAAAGTTCTGTGAACTCCGCATTGGTCGTCGCCACGGATGGAGACTACAAGTGCAGCTGTGGACACGC
GCCTTGGTCACCCAGGACGGACAATATTCAACGCACTATTTCGACATGCAGATTGGCCGTTGTTAGCTGTGGATCTGAGGATCAGACAAGATTTCAGCTG
TGAAGCATGTGTGAGAGGCAAGATGACGAGAAAGAGTTTTCACTCGGTGCAGAGTTCGAATCGTGACTGGTTAATTGGAGAACGAGCACACGTGGATGTT
TGGGGGCCGTATCCAGTGGCGTCATACTCGGGCATGCGCTACTTTGCTCTCTTCGTCGATGAGGCGTCTCGCTTCTCGACTTTGTTTCTGATGAAAGAGC
GCACCAACGTCTACGCAAAGTTCCAGTTCTACTATGAGCGAGTAAAAACACAATTGAAAATCCGAATGAAAGAGCTTCGTTGTGATAATGCTCGCGAACT
ACTAGCGCTCGGTGAAAAGTGCAAACGCACGTACGGAATGGAGTGCTCGCTGACGGTGAAGCATACCCCAGAGCAAAACGGAGTTGCTGAACGAATGATT
CGCACGGTGACTGAGAGGATGAGGTGCTTGCTGGAGCATTTCGGACTGCCCAAGCAGATGTGGGCGGAGGCCGCTGCCACCGCAGCGTATTGTGTAAACA
TAGTGCCGAACAAGAGAAAAGGAATGCAAGTCCCGTATGCAGTGTGGTTCAGAGAGACACCTGCGTATTCGAGACTTCGGACATTCGGTTGTGCTGTGTT
AGCTTACGTTGACAAAGTTGAGCGCAAGAAAATGGATTCACGAGCAAAAGAAGCTGTATTTGTTGGTTATTCTCGTGAGCGAAGAGGCTATCGGTTGCTG
GACAGCAAGACGAACAAGGCGTTCTACAGCCACACAGCGGTCTTCTATGAAGATAAACCTGGACGAATCCTGTTGAAGGATGGTACAGAGGCACCAACTG
TCCCCACGTCGGAGTATTTGGACATTAATGCTACGACGATGCAGAATATCCCAGCTTTGCTGGAGGAAGCTCAAGCTGAGGAGATGCCTGACTCAGAGTG
CAGAACTGGTGGGGCTAGTGGAGGTGCAGTGCCAGCTGAGGTTGCAGATGAAAGTCGTGCACAGCATTAGTGGTGCTTCTCGTGAGACTACTATATCACG
AAAAAGAGCGCGAGCGAGTGGCATCTCGGCTCCGCGCAAAAGAGTCCGCATAGACGAAAAGGTGGCACCAGGTGCAGAAGCAGCACCGGTGAAGGAAAAT
GCTCATCGTCAGAAGAAAAGAAAAAGAGGGAAAAGAAAGAAACCAAGTTGTGAACGGTGCGATACACCAAATGAAGAGTCTGATGGTCCGGGCAGTAGGC
GGTGTGCGACACCGGCTGTAGAGCAAGATGATAAGGAGACTGAAGGGCAGCAATCTTCCACTCGTTTGCCTGGTGCGATAGCGACCACCAGCAACGAGAC
GCTGGATGCTGATGGTGACTCGCCGATGGGGGACCTTACCGTCTCTGAGCAGCGAGATGCACCTCGCAGTAAGGCATCGAAGACTGGCTGCAGAGAATAC
CGGACGAAGAGTGGCCGAGTGTCGAAGCCACCACGGTGGCTAAGCGACACCATTCATCTTGCATACGGAGACTCAATTGAGAAGAAGAGGTCAGCTGGTT
CATCAAGCTGGGAGATGAAACGTGATGAAATGCAGTTTGAAATCGCAAAAGAGAAAGCAATGGATTGGTGGCAAGACTTCTGTTGTCTTTCGGCTAGTAT
GATTAATGAACCAGAGACCCTTGACGATGCAATGAATAGTGAATACTCAGAGGAGTGGCGATCAGCAGCAGACATCGAGTACCATGCATTGAAGAAAAAT
GACACATGGAAGCTGGTCCCTCGACGGAAAGGGATGAAGGTGCTCAGAAACCGGTGGATATTTCGTGTAAAGTATCTTCCTAATGGCAAAATTGAGAGGT
TCAAAGCCCGACTGGTGGTCAAGGGCTTTATGCAGGTCTATGGCGTGGACTACCTTGAAGTATACTCACCTGTGGTCCGCTTGGAGACTCTGCGGATGTT
GCTGACGCTGGCTGCAATCTGGGACTACGAAGTCGACCAGATGGACGTGACGACCGCATTCTTGAATGGCCCTATCGATAGAGAGGTGTACATGGAGCAA
CCAAAGGGGTACGAGGAAACAGGAAAAGAGGACTGGGTTTGCATGCTGGATAAAAGCCTGTATGGCTTAAAGCAAGCCCCTCGTGTTTGGTTTCGCCTAC
TGAAAGACCACCTAGAGAAGCAAGGCTTTACAATAATGAATTGTGAGGCTTGTGTTGCTGTGAAAGATATTGATGGTGAGCTAGTGTTTATCTCCATCTA
CGTGGATGATTTGATTCTATTCGCCCCCAACAAGAAGTTAATGAAGGAGCTGAAGCAGATGCTTCACGTGCGTTTCGAGATGAAGGACTTGGGGCCGATT
CACTACATCTTGGGCTGGGAGATAATGCGGAACAGAATGGAGCGGACAATTTTCATCAACCAGCGCAAGTATGCTGACAAAGTATTGCATCGATTTGGAA
TGGAAAGATGCAATGGCTGCAAAGTGCCAAGCACTCCTGACTTGAAGCTATCGAAGGTCATGTGTCCGACCACGAAAGAGGAGAAGGGCTTGATGAGTGG
AAAGCCGTACCGGGCTGTAATTGGCAGTCTAATGTACTTGATGTTGGGCACACGCCCTGATTTGGCTTACCTGGTCCGTGAGTGCAGTCAATTTCTCGAG
AACCCTGGAATTTTGCACTGGCGCGCTGCAAAGCGTGGGCTACGTTACTTAAAGGAGACGCAGGACTGGGGCCTACAATTAGGAGGAGTGCAATGGAGTC
AGCAGGAATTGAATGATCATCTCAAAGCTTTTGCAGATGCAGACTTTGCGAACCGAGTGGACGATCGGAAGTCTATTGCTGGGTATCTCACCCAGTTCTG
TGGCAGCACCATTTCTTGGGCAAGCCAGACAGAACGAACGGTCGCTTTGCACACGACAGAAGCAGAGTACATGGCGCTCAGCCTTCTTGTCCAAGAAGTC
ATACACCTGCGGCAGATGTTGAAAGAGCTGAAGGTAAAGCAGGACAACCCCTCAGATGTATTTGTGGATAACGAAAGCGCTCGAAAGTTGGCGAACAACC
CTGAATTTCACAGTCGGACAAAACACATTGATGTGCGACATCATTTTGTCCGAGAACGTGTTGAGCTGAACGAGATCACTGTGAAACGAGTCGCTGGGAC
TGACAATGTGGCTGATGCATTCACGAAGCCACTACCTCGTGTGAAACTTGAGCAACACCGAGCAAGCATGGGTTTGATTTCCCAAGGGCAATACGAGACT
ACCAAGAACTTGTGCAACGTTGACAACCAGTAGGTGGGGCTGTTGTGAATTACTGGTCCTCACCGGTTGCTACTGTTGCAGTTTAGCTTTTGTCTTACAG
CAAGTTGAAGTGTAGATACACAAAATGCTCAGGAGCTGGGAAAGGAGAGAGAAAAGCAAAGAGGGGGAAAACCACACAACAGAAAATACAACGGGAGCAG
CACGTCGCTTTACTCCCTCGCCCCGTGTTCGTCTTCTCTTTCTTGTTCGTTGTGCGGTGTGAGTTGCTGACGCACGCAAAAGCAGCCAAGTTACAAGTAG
TACAAAGACCGTCTCAAAGAGGGGGAGACAGTAGAGTACGCCCGTGCTTCCGGCGTTGGTTCCGTCATTGCGATTCCTGAAGTGTGACACATAACGGATA
CGACTGAGCACAAGTATAACAGGTTGCTATTTTTCGACATACAAAAAACGAGTCACGCGACGACCCTGTTGCATTTCCGATAGTGTGGGCCATGTCCAAG
TGGAGCAAGAAGAACCGCGCGCCCGCGGGCTACGCGTACATCGAGCCGGTGATGGACGCGCTGGAGCGCGAGCTGCGCGAGAAGATGAACGAGCCGCACG
AGGGCAAGCGCCAGTGCGAGGCGCTGTGGCCCGTGCACCAAATCAACTGGCAGCGCAGTCGCTACGTGTTCGACATGTTCCACAAGTACCACAAGATCCC
GCGCGAGGTCTACGACTACTGCGTCAAGCGCAAACTCGTGGACGCCAACCTCATCGCCAAGTGGAAAAAGCCGGGCTACGAGCGATTGTGCAGCACCTTT
GCTATTAACCCAAAGAACTACAACTACGGCACCGTCAGCATCTGCCGCGTGCCGAGGCAGCAGCTCTCGGAGGGGCAGGCGGTGCAGGAGAAGCACAGCG
GCTGCAGAGGGTGCGCGTCTGGACCCGGAGGGTACCACAACATCTTTGGCAACAAGTACGGGCAGTACCTGGCCCGGATTCAGATCGCCAGGGAAGACGC
AGCCAAGGACGTGAAGCAGATCTGGGCCACGGAGGAGGACGAAGACGGGAGTGGAGAGGAAGATAAGAAGAGGAAGAGGCAAGAACCGACCCAGGAGAGC
GAGAGTGAGGAGAGTGAGGACAGCGAGAGTGAAGAGGAAGAGACCAAGGAGTCTGAACCCCCATCCAAGATGCAGAAGGCAGAGTG