Transcript Name :
Phyra_g3
Orientation:
(-)
Number of Exons:
13
Description :
hypothetical protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Ribonuclease H domain9.329PS50879
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-1069
*** None ***
PositionContextScore
532GSARVKR|SG0.843
*** None ***
GO
Biological ProcessGO IDPrediction Method
nucleic acid bindingGO:0003676IEA
RNA-DNA hybrid ribonuclease activityGO:0004523IEA
*** None ***
*** None ***
Sequence
        13867 bases(100 bases per row)
TGGTGCGCGTGCCCGGATCTTCTGGTGACTCTCAGGGATTTCACCGTGAGTCCACCGAAGAAGATGTTAAGATCAAGACGGAACCAGGGAACGAGACGTC
GACGGAAGATGGATCGCCGCCGACGGCGCTGAAAGTGCCAGGATCATCTGATCGCGAGAGTGCTGGGAGGAGCTCTGACGATGTGATAGAGGAAGGTTCA
GCGATGGACCTAGAAGAAAAGCCTCCCCCTCCCCTCCCCAGGACCCCCGCGGATCGCGATGCGAATCGCGATCCGCCGGACGAAGATCCGACGGTGAAAA
CCGAAGGACCTTCATCCAAAACCACTCCTCCAGCCTCGTACCCAACCGCGAAGAAGAACAAGTCAAAGACCTCACGCAAGAAGCTGAAGGCACCGGAGTC
TGAAAGCCGAAGACCAGGAGGATCGCAACACGTGGACGGATGAGCAACTGGAGTCTGCCTTCTTCTACAAGGACCTGTACAAGTTCCTGCATGAAGATCC
TGTAATGAAGATCGTGCGTCCCAAGCCAATCGGAGAACTTCAAGGTCCGGTGAAGGCGCCAAAGGAGGTGACCAACTAGCTTGACGCAGTCAAACTCCTG
ATGCGAATGTTGAAGGGAGCAGGAATCGTACTTGGTTCGTTCAACGCGAACGAATTGTTCGACCTGGCGTTGCCGGTCATCAGGGAAGCTACGTTAAACC
TGTTCACGAAGCTGACGCCCCTTGTCGGAAGCGTCGTCCCGGTTCAACGTACAAGACCAACACCGACTCGCAGCCAAACTGGATCGTCACAATATGCCTC
AGCCACATCGGAAGCAGGATCGGACAGCTCGATCAAGCTGCAGCGGATGACGCTTGGACCAGCTGGAGCAACCATGCTACAATCGCGAAAAGAGCGATCG
GAAGCCAAGCCGACGGAGATCGTACCACACGATCCAGTCCAAGCGCCGCCCGAACGCATGCAATCATTCTTCAATGCAGCGATGGAACGTTTCCTGAAGG
AACAGCAAACGACCGTGACACCGCCAGCTGCTGTCCAGAACAGTCCAACCGGAGCTCAAGACGTGGACATGGAGTCCGTGGGATCGAACCGCCCGGATCA
TTCGCATCCAAGTGAGTACGATCCGGACGACTTGAACGTCGGTGTTACTCCTCGTGCCGCAGTCGCTTCTGCTGGAGCCACGAGCGGCGGAGCACTCTCT
GCCACCCGCATCAGGGTTTCTGCGATCTCGGAACTAAAGGAATTCTCCGGGAAGGATAACGACGAAGATCGCGCTAGAAGCTGGTTCAGCAAACTGAAGT
CTGCTTTCACTCGTGATCAAGCTCCAGACGGCGAGAAGTGTCTGGTGTTTGGAGATTTGCTCACTGGTCCAGCGCGCAACTGGTACCGACAGCTAAGTCG
AACGACGCGTGGCAACTGGAAGGAGCTATCCAAGAACTTCCAGACCCAATACTGCGGGCGTGGTGTATCTGTCGCGAGACAGTATTACCATGCGCGGAAG
AGATCGGACGAATCGCCGTTGGAATATCTGCACCGTTTGAATGTCGCGGGTTTGAGAGCTCAGCTCTCGATCAAGGATGGATCGATCGAGACCCGCCGTG
AGCATGTCGATCACTTTATCGAAACGCTCGACGATCGCGATCTGGCCAGCCAACTGGCGCTGCTCAGAATCCCGGATGCAGACACTCTCGAAGAAACACT
GCGATCCCGACAACGCGCGAAGGCGAGGCAGGGAAAAACGGTGTATGGATCCATCAAACCCAAGCAGAAGACGCCAACTGGGATCACCCCATCCGCCAAC
GCTCGCGCGGTTCGTACAGTCCGTACAATGGCCAACTCGAGTGAGTCCGAACCGGAAACCAGCGGATCGGAAGGAGAAGGCGATCTGCGCAAGGTGTACT
TCGCGGCAACGCCTGACCAGCCGACTCGATTGCGATCGGATCAAGATCAACGTCGTCTTAGTCGAGACTCCAACGACCGTCGCCTCGATCGTCCCACCGG
ACTACCCGAAGGAGACATCCCGCGGAAGCCATGTTCCCACTGTGGATCGTCGAAGCACACCGATCTTGGTTGCTGGAAGCGTCTGACGTGCGAGAAGTGC
GGCAAGAAGGGTCACCCTACTGACCGCTGCCTCTTCGTCTGCAAGGCCTGCGGCGAGATCCACGGGGCTGGAGAGTGCCCGATGGAAGAGTTTTACAACT
TGATCCGCCAATGGTATAACCCGAACAAGCACGGTGGAATGCTCCCGCAAGCGGCCGAAAAGATGTTAAACTAGATCGCCGCCGGGTTTGAATCCGGTAC
GAGACGAGCGTTCTCAGTTCTGCATCTATGCATATGTCGAGAAACAGTCGAAGTCAGAGGTGAGTAAGCTGATTCGGCCGACTGACAATACATGTGATCT
TCATGACAAGCGTACCGTGGCGATTTCCAGCCTGCATCAGATCGACGAGTATTCGCGATCAGAAGTGACAATGGCTTTGGATCTTCTGCACGGAGAGTCA
CGAGGATATTGGAAGTACCATGTGCCAGACAAGAAGTTTCGGCAGGCGAAAGCCATGGGGAAGATCAACAACGAAAGGGCCACATTGCTGTTTGACAGCG
GCGCCGAGGTGTCCATTCTGGATGCCGCCTTTGCTCGTAAGGTTGGGTGCTACGTGGACAAAAGTCAAGAGTTGGAATGTGAAGGAGTTGGTAAGAGTCC
CTACATGGCGGATGGACGTACCAGAATCAAGATCACGCTCGCGGGATCACTGGTGTACTACTTCGACGTTTGGGTTGGTCCACCCACAGGTGGCCAAGAC
CTGATCCTGGGGATGGATTTCATGGTGCCAGCTGGCATCCGCCTCGATCTGGCTGACGGTTCGATAAATCTTCCGGACGAGGTGCGGATTCAGATAGCCG
GTCGACGTCAGCTCTACGGTGAGAAAGTTACGCAGGTCAAGCTCGGAGAGCATTGCCAGCTGGAGGTCGGAGCGTCGGTCGAAGTCCGAAAGGGTTTCAT
CCTGTCGAGCCACCGGAGGTTGTGGGTTACCCGAGGGGAACGATGGGTACCGAGTTTAGTCGCCGGATTAGGGAAAACGCGCTATCTGAGGGTCACGAAC
GTCAGCGATCAGAAGTTAGTGTTACAAGATGATACCCACATCGGTATGTGGCTCGAAGGAGGACGCGTACCTCGTATCCCTGGGTTCATATTGGTTGGAT
CGCGTCGGTATGCCGAGTGGCAGAATCTGGCGTTCCAGTCCACCACAGACCGTGCGGATGCGAAGGAACCTGAGTTGGCGCCCATCGGACCCATGGTAGA
TCGACCCCGGTACGACAGTCCGACGGAAGTCTTGCGCCGCGATCATGGAGCCCCGAAGCCGGTCGTCGCACAACTAGCCGCGGCCCAACCCGCTAAGATG
AGATCAGAACCCGAAGGATCCCCGAGAAATCAGGAAGATTCTTCGCCCAGGTCCGAGACGCGACTACCCGACGACGAGGAAGTATGTTACCACGAAGGTG
GCGATCTCTTCGCTGAAGATGTGGAGCGTCAGTTGGCAATTCTACCAGAAGTAGTGACTGCCACCGATGAGGTTACGATCGAAGATATCCAGTGGGCGAT
CCAGAGTCGAACACCCGGAAGAAATCGATCGGCTGCGACAGATAATTTGGAGACGGAAACATCTTCTGATCGGGAAAGGAACGCGCTACCGCCGGCGCCG
TTGGCGCAGTCTGCGACATCGATGTGGGAGGAGCGGCTCCTGTTGCACAACGCGTCCGGAAAGTCGCTCCACAGTTCCGCGAGAAGCTGTCGGATCTGAT
CAAGAGCCTGTTATCGGCGAAGATGATCACGCCGTCGACTTCACCGTGGGCGTCCCCGATCGTAATCATCATCAAGAAGAACGGCGTTGACATCCGGCTC
TGTATTGACTACAGGCTGGTGAATAGTTTGACGAGACTGATGGTGTACCCCATGCCGCTGATTTGCGACCTCCTGGAAGACCTGGACAAAATGCTCTGGT
ATTGCTCACTTGACATGGCAAGTGGTTTCTGGGTAGTCTCCATGACGGAGAGTGCACGGAAAATCTCCGCTTTTATCACGCCATTCGGGTTGTTCGAGTG
GACGCGTATGCCTTTCGGGCTGAAGAATGCGCCACAGATCTACCAGCGGTTGATTGATAACGCGCTGTATGGACATCTCCGAATCCGCGCCGGTCACGAT
TCGTCGAAGCCAATCGACGTGTTCAATTCAGGCGAGCCGGAACTAGAGCCGAAACCGTCAGTGTTGGGAAGACGATCGTACATCGATGACATTTTGGTGA
CTGCGATCACTTGGGACTTGCTGTGTGAGAAGGTTGAAGCATTACTCGATGCTTGCGAACGGTGGAATTTGTCCATCAGTGTGGTCAAAAGTTTCTGTGG
CCGACGAAAAGTGGACTACTTGGGACACCGAGTGTCCGTCGACGGTTTGGAAGCCCACCCAAAAGATCTTGAAGTGTTAGGCAACCTTCCCTTCCCGCAG
ACACTGCGATCGATGCAGTCCTTCCTTGGAAGCTTGAACTACTACAGTCGCTTCATCGAAGACTTCGCGATCTATGCGGCCGTCTTGTACGAACTGCGTG
AAGCGGATTTCCACGAGATTGCCCGACAGGACAGATCCATTCCCAGCGAACAAGTAACTGGGGGCGATGTCCCGCGAGCGGAAGACGCTGACCGCTGGGC
CCGAGCGAAGATCGCGTTCACAATGTTGAAGGCCAAAAATCGTGTCCACACCGATCCTGAAGCATTTCGACGCAGATCGCACTCCAGTGATCGTAGTTTA
CGCGAGTCAGTGGGCGATCTCCGCGGCTCTTGTGCAAGAACATGATGGCGTGTACTGGCCAGTAACCTTCACCAGTCGTACCCTGAAACCGAATGAGATC
AATTACGGGATCGTCGACAAAGAAGTTCTGGCGCTCTTGCGGATGCTGGACGTGAATTACACCTTGCTGACGACGAGATCGATCTTGGTGCTGTCCAGGC
ATTCGACGCTGGCTTGGTTAGTCAATTCGGCCGGTCTCCAAGGGAGACTTGGCAACTGGGCAGCCTTGCTATCAGAATGGACACTGGAGATCAGGAAGTG
CGCGAAAGGGGAAGACGAAATCTTAGGCACGATGGCAGCAAGCATCACACCTCGAGCGGAAGTAGACGAGGCGTTGATCGCGATCGCACCCGTGAAGCAG
CCCCGACAGACGATTACCATGCCACCCCCTACGATCGGAGCGGACGAAACTTTGTTGGTCGCGAGCTTCGATGGATCGGCACGCGTCAAACGCAGTGGTG
GAGCTTACAGTGCGATCATATGGAAGTTGCCAGAGTGGACGATCGTCACCTCCGCTTCGGAGTATATGCCCGATCTAACGGTGAAGGAGGCGGAGTACCG
CGGGTTGTTGTTATGCTTCGATCTGCTGTCCACGATGGACAGTGGGCGGATTGTGATCTGCGGCGACTCCAATTTAGTTATCCGGCAAATGCGTGGTGAG
ATCGCATGCAAGGCCCCTGGCCTGTTGTTGTTGCGCGAGAAAGCGATGGATCGGCTCAGGTCGTGGCCAAAGCACGAGTTCCTACACATGAAACGAGATT
GGAACCAGAGTGCAGACAAGTTAGCCAGTGAAGCTCTCCAACGAGGCGAAGGGATCGTAGTCACCTCAGACGAAGATCAACAAGACTTGATCACGCTCAA
CCGTTTGGACGAGCTCCTCAAGATGAGGGACGACGATGCCGTCGTCCGTGTGTCTGCTGTGACCAGATCGACGCGACGCAGACGACTGAGTCCTGAAGTC
CTGCAAGAAGCGATTGTACAGCGTATACGCGGTGAGCGAATCATCCAAGCACAGAATGAAGAGAAGTGGATCGTCGATCTGAAAGCATACCTGAAAGGGA
ACGTCGAGGCTCTCACCGCGGCCGAAGCTAAATCGTGCGCCAAGGTCGCGAACGATTACGAGATGGACGAAAACGATCTGCTGTTCTATTGCCCGTCGGC
CATGCGGCAGGAGGAGGACCGTGACGAGATCGCGAAGCTGGTGGTGCCTGAGACCCTGCAACAAGATTTCTACATCATACCACGCAAGTCTGGAAGGGGG
ACATCAAGGGATCGGAAGGACGTACCGACGAATCCGATCACACTTCCACTGGAGGGGCTTATACCGAAGTGTTCAGCGCTATGTGGGAGAATGTACAGAT
TGTGAGACAGGGAAAGGCCGACCCTTCGTGAGAGGAGAATCCCCTGGGAACGTGCAAGCGACGTACCCGTTTCAAATCATCGCTATGGACCACATTCCGT
CGTTGCCCAAGTCCTTCAAAGCCAATACGGAGCTGTTGATCTGGGTAGACCTGTTCTCGGGTTATGTGATCGCTAAAGCGAGCGCGTCAAGAACAGCGCA
GACGATTGCGGAGAACTACGAGGAATGCGTCTTCCGGCGTTTTGGAGCCAGTGAGGCTATCCGGCATGACAGGGAACCTGGGTTCATGTCTGATTTTTTC
CGTGCTTTTAGCAGGATAGTGGGACAGAAACAGAGGGCCACTATGGCTTATCGACCGCAGGCCAATGGGACGGCAGAACGGATGGTGCAAACGTTGACAC
GCGCGCTGAAGATGTATGTCGCAGACGTCAACCAACAGGACTGGGATGAGTACGCGGAGTGACTGACGTTCGCGCTCAACACGGCCCAAGATCGGGTTCG
AGGAGATACGCCGTTCTACTTGACACACGGGTGGGACCGCAATCTACGTTAGAAGCGTCGCTACCTCTCGGAAGCACGCGCCGGGATCGTGACCCTCGTC
GGTGGAGATATCATATACAGAGCCACTATCGTCGAGCCAGAGAAGAGGTTAATGAGTCCCTGCGGGAGGCCATTCAAGGACGAGCAGACGGGCATAATGA
TCAGGTCCGACCTCATGGGATTGAGGCCAATATGCAAGTGTGGCTGTACCTAGATCGCGTGAAGGAGGGCTATGCACGCAAGTTAGCCCACATGTGGCAC
GGACCGTTCAGGGTGATCGAGATGCTTGACAATCATGCAGCAAGGTTGGAAGTCGCTGGCACCAACTATCGGTTATTCCCGATCGTCCATGTGTCAAAAC
TCAAGCCTGTGCGATCGTTCCTCGATCGCCCCACGCTGACGCTGGTGGTGGACGAAGAAGATCGCTTCGACTTTGATGAGGCGCTTTTACCCGAGGACAG
CTGGGAAGGCGGTCTCGATGAGGACGAGTTCGAGGTGGAGAAGATCGTGAATATGCGATCAGGTCGACGGTACGCGATATGGTCGCGTCCACCGGGAATT
TCAGGTGCGCTGGAAGGGTTACGATCAGCTTTCGTGGGTTGATGAAGCCGATCTGAATTGCGGAGCCTTGTTGCGCGAATACGAGCGAGGAGTCGTCAAC
CGGAATCGCTTCGCTGTGATGCAGTCGCACGAGGTGGAGGAGGAGAGCTCGTAGCAGGCTGGCTGTTGCGGGCGGAGGAGTGGTGTGAACAATGTGTGAG
GTGGTCGCACATTGAGGTGGAAGGGTTTTTATGTGATATTGTTGTGTAGATCGAGGACGACTGTTCTCGATCAGAGCGGGATGCTCGATAAAGCAAGAAA
ATGATGAAGAAAAACAACGAAGGAAGAAGCCGTGGAGATCATGTTGAGAAGATATACGATCCACTAACTACCTCATCTTAGTCGGCGACAGGAGAGAATT
TGCCGGTGAGGCGGGGCAGTTGGGAGCCCGGATGATCTTGAAGGTGGCCGCGATACTGATTGCGCCACGGGTCAACCAGATCGACGGCACGTAGGGCGTC
TACCAGGTTGGATGGCTGAGAGCTGCAACCAAGCCCCAGGGTACCAAACTCGTTGTTCGTGCGCCCGGGGATAATGCAGAAAGAAAGGGTCCAGCAGAAT
ATCCAAGTCGCAGTGCCCTGCAATCATCCCTTGCAGGATCAACTTGAGGAAGCGTTTCCAGACGGCACCGAAACGTGATCGTCTCTGCTTGCGATCTTCC
CAAAGACGTGCCAGATATGTGTTCGATTTACGAAGCGCGGAGCTGATCATGAACGCGTGCGTAGCCTCCCATAGAGCCTGCCGGTGATCATCTTCAATTT
CCAGATACTTCCGAGACATCGCCTCGAACCAACCAGTCACCTCAAAAAATAAAGGCGTCACCAAGACGTTGAGAGAATTCCACGGCGTCGTCGCGTAAAG
TGCCGCAATGTTGCTTTCGGTGATCAGACCGGGTGACCAAGCGCCGCGACGAGGCGATCGACTCTGCGGCGGAAAAAGCCAGTTTGTAGGCTTTGCCAGG
TGATGAAAGAGCAACTCGATGTCCATCTCTAAGACACTGACCCGGCTCAAAGCGCTCGCCGACCACGGGCGAACGTCCGCGGCCGCCCTACGAGAACGAG
CGCGATATCCAGGGATCCAGATAGCACGGGGAACGGTGGGACGAGCAAGCTGATCCAGGGCAACCTGCGTGAGTAGGTGATTGCGGTGCGCCCGCGGTTC
ATCAGCTACGCTTCCGTCACTGTCACCGTCATTCTCGTTGCCACGATCGGAATCACGTGGCGCATGTCCGCACCACCATCACTCTCGTCACCGGAAGAGG
CACTGCCAGGGTCGTCCTCCAACTCTTCGAGTTGATCAGGATCCTGGTTCGAAGCCTCCGAAGAACTGGACGACTCGATGTCGATGGGGCGGCTGGATGA
TCGACCGCTAAGGCTGCCGGTGGAAGACGAACGGCGACGACCGGACGATCGCGAACTTGCGAGAGCCGCCAACAGAGAGTCGTCGTCACTACTGGTCGGA
GAGGCATTAACCGATGGTGACCGCTGAGATGGAGAGCGATCGCCACCAGAGAGCCTGCCGGAGTTAGGAGTTGACGGTCCTGAAAGAAAAAGAGATCGCG
AAGCAGATCCACCGTGAGAAGGCGGAACAGTACTTGATTCCGACACTGGTTTAGGAGATCGCTGTCGCGGACGACTACGGGGCGGACTCGAGCTGCCAGC
CGAAGAACTACCGCGCGGTCGCTTGGCCGTTTTCTTGGATGCGGCAGGCGTCGACTTGGAAGAGGAAGTAAGTGGCGTTTCGTCTTGCGCGGGTTGGATG
AATGAGATCAACCCCGCCACCCTATGACGGAGCTGATCGCGGTCCCTGTACAGCACGGTCACAAGCCTTCTTGAGAGCAGAAGACGCAGACTGCGCGTTG
GCCAAGTCAGCAAGGAGCAACTCATTCTCGTGATTGAGCGCCTTGATGCGGCTGCGATCTGCCTGCGAGGCCTTCAGGCCATGCTCCAATCGCGCGATTG
AAGCCCGCGCGTTATCAACTTGGATCTCTGGTACAACACATAGAGGAACAATGTTAGTGTCACGCACGAAAGATGTATCGGATGCGAGGCGGACTTACGA
GTAGATCGACGGTCAGCTTGCGCTCGATCGCGATCGGCCATAACCCGCTGCAGGTTCTTGGACGTGGTCTGGAGAGTGACCCCAGCAGCCTCTGCACGAG
AACGGAACTGTTCCCTCTCTGCGTCAACACGATCGAAGTTCCGCTTGGCCCGAGCTGTTTGTTGAGCCAGCTGCGCTTGAAGATTAGACACGCGCTGCTC
GAGACGTTCGTTTTGACCGCGTAGTCGAGACGTCGCGTCTTCCAATGCACGCTGCGACGACTCAAGTGCACCAAGGTTCTTGTTGGCTTCGACCAAATCC
AAAGCGGCGCGGTCGCGATCTGCGATCGCCTGGTCCAACCCTTCCTGTAATGTGGCGAGACGACGTGCTGACCCATGCGGCTGCTTTGTAGCCACCGGAG
ACTCTGCATCAGCCAGACGACGAGTTGATCGGCAAACTCCGCCTGTAATCGCGTGGTTTCCTCCGCGAGGACCTCCTGTGCGACGCGCAAACGATCCCGC
ATGGCTGCGATCTCGTGCGAATTGTCGAGACGCTCGCGCACTGCCGCTTCGAAGTCGGCCGCCATCTGCCGGGTTTCTTGATAGCGCCGGAATAGGAGAT
CATATTGGTGCTGGCAATGCAACACATAGGGAGAAGCAGCCGCGTACGCGGCGTTCAGATCGGCCTCCAATCGATCCGCTCGCGCAACTTGGTCCACGAT
ATGCCTGCTGCAATACTGCATGAGCATCGTCGAGATCAGCTTGAGCTTCGATGCGTTCCAGCAGGGACGAGAATAATGCGAGAGAGTCCCGGGCGGCACC
GAGGTTAACGCTAGGAAGTGCGACGCGAGCAGTAGAGACGACCGGAGCCTCGGAGGTGTGATCGGCGGACGTATCAGGCGCGACGACGAGAGGATCGTCG
GACGGTGCGTCAGCTGCACCAGCCATAACTGGGGCTGGCACGGAATTCCCCGGTGGTGGTTCAGAGAAGGAAGCGGAAATGTGATGGAGTGCGCTGAGAC
CAACCGCCGTACGGCTGGTCGCAGAGCAGGGGGCGATTGAGGTGAAGCGACCTGGGTCAAATTGCCGATGATGGGAAGAGATCGCGTCTGGACTGATTGG
ACCAGAAGGGTTGGGGTTGGTGCCGGATATGTCCGGATAGCCCAGCACCTGACTTGGTACCACAATGATGGTACAGGTAATTTTATCGCCTGGTACCACC
CTTTCGGTACAGTCGATCATCCGGACGCTTGCGATCAACCAGACATCTGCGATCATCTGGGCATACGCGATCATCTGGACTCACCTGATCAGATCGACAT
GGTACCGCCACAGTGGTACAGTTGGATCGGATGGATGCTAGGTACAATGTTACTGTCATTCCGATACGAGGTCAAGATATACAGATGGAAGTTCAAGTGT
GATGTGCAGTCGGTGGGCACGCAAGCGGGATGGGGATAGGGAGAGAGATCTTTAGGACTTTTACTTTTGCTTAAATAGATTCTGATTTGCCTTGCAAGAC
ACAAGTGGCGTCCACACATCCCGGGGAAGGAACTACATTGGCCTACCCGAAGAAGGGCTCACCTAGTCAACCAAGGACACGTCGCACATCTGGATAGCTT
GGCCAGGGGGCGATCGTACAATCTCATCTCAACTCAAGACCCCGCCAGAGGAGGCGGCAAGCAACGGAAAGGGCTATAACAGCACACCCAAAGGACACCC
CCCACGTGATCGACTTACCCCAAGACCCGATCACCAACAACCGACGACCGCGTGAAGAATACCTGCGTGGCCGTCATCCCCCCATTCCCCGGAAGGAGCA
GTCCAGCTCCAACAAGTTCCGCCTTGGTCACACCCTTGACGTCCTTCAAGAGAACACCGGAAGAGCGTAACCCGCCCCGCCGTCGGGTACACAAGGTGAC
TACAAGGTTTTCTGATCACGCCTGATCAACGGAGTACCCCCTCCGATAGTCGGCAGTCCGGGCGTACCGCTGGTGAGTTTGGATCGCATCATCCATTTTT
GCGATCCCACTCCAACCACAGAAGTGTTAGGAGTATACAAACTCCAAGTGAACGGCGGTTCACTAGTTCCCGGTCTTGGGGAACGGTTGACTTAGATAAC
GTAGTTTATAGACTGATATGTTTATAATTAGTTACCTAGAGATCGTCTTGCAATACAATTCCTAAGTCAACTTTAGTTTATCCTATATGTTTTATGTATG
GGTGGCTGTGAGCCACCATCACGTGTCAGTGATGTTGGGTACACCATGTACCCAACTCGGAAGAGTGACGGGCACTCTTCAGGTAACCCCGTTACATTAT
ATCCGAGATTTTTTTTTAACCCTTTCGCGAGGAGCTGCTATAGACTCTACGAACTATACTATACAAAGTCAAGTCAATTAAACTCAAAGGGCGCAAAATT
CGCCCTTTTAGTTGTCGATAGAGACGGGGCGTGTGTGCAAATCAAACACGATGCAGTCGGCACTGATGATGTCCAACCTAAAAGGGCGCAAAATGCGCCC
TTTTAGATTGCATTTTGATTGGCTAATAAGTGAAATTATTTGGTGTGATCCAGCTGAAACAGCCCTCTACTACTGGGATTGGTCAAAATGGAATGATACA
GCGTTCCACCACGGAAAGATAACAGCGAAACTTACGAAGATATTCGCCTCGTCGACCGTTTTCTGGGTGATGACGCGCCAACGTTGGCCGGAGGATGATG
CTCGGCTTCGGCTTTCGCGTGCGCTATATATCGCACCACTCTCTACCGGACGTGACTAGTTGGCTATAGCTCTGTATCTGGCTCGTTTTGTCGCCAGCAT
TCTCACAGCTAATCGCTTCAGGTACAGCTACACAGCCAGTATGTTTGTATTCCCGGCAATGTAGAGCAATGAATATGCGGGTCACTCAATGGGTGCATAT
ATCTTCGTGTTCGTATGACTCCGTTAAGGTATACTACGTAGTATCTTCGACGCAATGCTCTGGTGCATATATCTTGCACACTGTATTCCAAAAGGGGGAT
TGCGTACGAAACGCTTTTCGCGCCAAATCATGGCGCCCAAAGCTTGGTCCCTACTGTCAGACTTCATAGCTTGTACGTTTGTATGTGTATAAAGAATAAA
GACTCATCCAATATCTGTATTTAGAAACCTTTATATTGACCACAAACACACGACACGTATCAACCTTCCAGCTGATTCCTTCTCTCATTTCTAAAAGGAG
CCGTATATGGCGGAAGCGCTGCCCGGGCAGAAGCGCAAGTGTACCGGTCCTGTAGGCGCCAGCAAGCGCCGCCGCGCGGGATCTGGTGTCGATACAGCAC
CGGCGGAGTCCGCCAGCAGTCTCGGAGGTGTTGCAGTGTTCAAGGGCGCGTGGGCCGCGCTGAAGAAAGCAGGATGGACGTCCAAGAAACCGTCCAGCAA
GGGTCTTGACTCGCGTTACAAGTACATTCGGCCTGGGGTGTAGAGGGTGCTGATTTCCTTCTCGGCGAGCTGGCCGTGCTGAGGTATGTCGAGGAGGTGC
GCAACCGTGACGCCGCAGCAACTGCAGCTAGGCAAGACGTTATGTCTGTGCATGCAGCGGTATGACAAGTGGCTAGGTAGCTGTATGGCTAACGTTGCAC
TTGTTTGTGGTGTAGGCGTTGGAGCTCAACGTGGAGAAGACAGTGGCGACGTCGCTGGCAGAGCTGCTGGACAGGCAGTCACTGCCGAACGTCGCCGGCA
AGGATCTAGGCATGGCGACGCCGATCAGGAAGCCTCAAGCGCTGCAGGTGCGGTTGCGTCTTGGGAAGTTGGGCTACAACAACGAGTGGCGCGACTAACG
TTGTGTTTGTTGGTGGTTTGACTAACGGTGGGCGCATTGGTAACGCAGAGAATTATGTCAGCGATGAAGTCATGGAAAGCGTCAGTACAGCGGCGGTGGT
CGCTCACGACCAAGCAGTAGTGACCGTGCCTCTAGTGCACGTAGGTAGACGACGAGAAGGTACGGTTCGTCCGGCTGCAAGCGTCGCCAGCCCAGTAGGT
GCGACTTGTAACAAAAGGCAGCGTGAGGAATGAGCGCGTGCCGTGACTAACTATCGGTTTGGTGTTGATGCAGGAGTTGACGGCAGCATCGTTGACATGA
CCGACGACGTCATGGTGGACGCTGAAGGTGCTGCCGACCAGGCAGGTGTCGCTGTGCCTATTGAGAACGAGCGTGGTGGACGTGGTGAGCGTGGTGGACG
TGGTGCGCGTAGTGCGCGTGGTGAACGTGGTGCGCGTGGAGGACGTGGCGCACGTGGTGGAAGCGGCGCGCGTGGTGAACGTGGTGCGCGTGGGGGACGC
GGTGAACGGGCTGCTCAGCGTGCAGCTCGAGCCACAGGTACTAGAAATGGGGTGCTGGATCTCAGAGTGCAAGCAGAAATAGATAAGCTAATGGTGTGTT
GCTGGTTTTGCAGGAGCTGGTGCGCGTGGCGGTGATAATGGTGACACGGCTGGAGCAGTCGTTGTGA