Transcript Name :
Phyra_g14
Orientation:
(-)
Number of Exons:
1
Description :
XP_009530975.1 hypothetical protein PHYSODRAFT_511709 [Phytophthora sojae
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Phox homologous domain10.052PS50195
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-521
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
protein bindingGO:0005515IEA
*** None ***
*** None ***
Sequence
        1565 bases(100 bases per row)
TGGCGTACCTGACCATGACGCCCGACGACATCCAGGGCGACTACGTGTGCGCCGTCTCGGTGGACGACTACCGCCTCTCGAGCAAGAAGGCCGAGTACAA
GGTGGTCGTGCAGCTCTCCTTCTACTCGTCGCGCGCGCACGCTACGGGGCGCACGAGCTGGCACATCTGGAGAAGCTTCTCAGCCTTCCGTAAGCTGGAC
GAGCAGCTGCGTAAGCGCAGCGCCGCGCTCATGAAGGGCGTCAAGTTCCCGCCGCTGTACCGGCGCAAGGCGCTGTTCCGCGTCGACAAGAGCCCCGAGT
TCCTTGGAGCGCGCGCCCGAGAGCTCGACAACTACGTCAACGTCGTCACGCACAAGCCCCAGCTCGTGGCCTTCCACCTGGCGGCTGTGAGTAGCCAAAC
GCTCAAGAGCTTCGTGGGCTTCAACTCGGGCTTCGGCGCCAACGCCGACTACGACCAACAGGACATCAACTTGCGACCTTCGTCGTCCATTTTGGCGTCC
CCCGCGGTGGTACAAGCTACAGCCAGTGTCATGGGGGATGACGATGATGATTTCCGTTCGGTTTCCAGTAGCTCCACAGTCTCGTCCTTTGCTTCGAACT
CCAGCGACTATCGATGGTCCGGCACGGGTTTTGTCGGTAGCCAGAGCTTTGCGAGACACACAGTGCCTCAGATGGGGCCTCGTACGAGTTTCGCCAGCAG
TAGCAGAGGATCCTTTGCCGGCAGCTCCTTTGGGGGCTCCATGGGCCCCGGATCGTCCAGAGGCAGCTGGTTCCCGGCGTCGTCCACGGTCTCAGATACC
ACGGGGCGAGCGTCCATGGCATCCGTCTCGAGAGGGTCCATGATGGCCATGACGGCGCCGGATATCATCACTCCGGAGCTGGACATGCAGCGAGCCAAGA
TGGAGGATCAGCTCGTGCAGCTGGGGCTCGTGGGCGTGGGGATGCCCCCCGACGGCTCGTGTCTGCTGCACTGCATCGTGTACGAGATGTACCCGCTGCA
GTGTCTGCGTGACTACCCGGCGGGGATGACGGTGGTCAATGTAGGCGCGGCGGACGGGATGGCGCCCCGGCGGGTTGCAGCCGCGCAGTTTTTGCGCGTC
AAGCTCATGGACTATGCGTTGGATCACATTAAGGAGCTCTCAGGTTTCCTCATGCAGGACGAAGAGGACGTGCGCGAACGGTACGAGACGTTTAGGGACA
CGCCCGACGAGCAGGCGACCACTGCGGAGCTGTACGCGGTGGCCAGCATGTTCAACATCGAGTTGGTGCTCATCTCCAACGACGAGAGCTTCCAGATCGA
CCCCGTGCTGCCGGTACAGGGCCTGCCGTCGGTGCGTGAGGGTCCGCGACGCACAGTCACACTGGGCTACTTGATCCCGGCCGACGGCCTTGCCGGCCAC
TACATCTGCGCGCGCGAGCGACGGGCGCAAGTTGGCATGCCGCAGAACAACTTCGCCGGAGGAAGCTACCGCGGATCCATCCACATCGGACCTCCCAAGA
ATATGAGCTGTGGCGCCTCCAACAACCGGCGCTTCGAGCGGATCCCGGAGACGCGGGTGGAATAG