Transcript Name :
Phyra_g23
Orientation:
(-)
Number of Exons:
8
Description :
hypothetical protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
HmmSmart predictionP-Valprediction_id
Pectate lyase/Amb allergen0.00000065SM00656
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
Pectate lyase/Amb allergenIPR002022
*** None ***
InsideOutsideTMhelix
1-1212
NN-scoreoddsWeighted Score
0.7472.9880.006
*** None ***
TypeScore
endoplasmic reticulum55.6
GO
*** None ***
*** None ***
*** None ***
Sequence
        7097 bases(100 bases per row)
TGCAGTTCTTCCGTCCCATTCTCATTGTGGTGGTGGCTATCGTGGTCCAGGCCACGGACGCCTTCACGGTCGGATCGGCCACCGGTCTCGCTGCCGGAAC
CACAGGCGGAGGCAGCGCCACCCCCGTGTACCCCACCACGACGGCGCAGCTCGTCGCGTACCTAAAGGACGCCGTGCCCCGTGTCATCGTGCTCAACAAG
ACGTTCGACTTCCGCGGCACGGAGGGCACGACGACCGAAGCTGGTTGCCGCCCAGACTACACCCGGGAGTGTATCGCCAAGAACAATGGCTACAAGAGCC
AGGATGTCATCCTGCAGAGCGGTGGCATGTCCAACACGGGTGGCTGCTCGGACGGCACCAGCGTGACGGTCACGTACGACAACGCAGCCATCACCCCACT
CACGGTGACTGGCAGCAAGACCATCCGCGGCATTGGCACGAGCGGTGTCATCATGGGCAAGGGTCTGTGGCTGAACGGCGACAATATCATCGTGCAAAAC
ATCCACATCACGGAGCTCAACCGCCACTTGGTGTGGGGTGGCGACGCCTTCTACATGCAGGGCAGCAACGGCGGCTCGACGGCCATGAACAAGATCTGGC
TGGACCACATCAAGGTCTCCCACGTCGGCCGTCAGTTCTTGACGACGAACGCCGCCAGTGTGTCCACGATGACCATCAGCAACTCGGACTTCGACGGCCG
CACGGACTACTCGGCTACGTGTGACGGTCGCCACTACTGGTCCTTCATCTTCTACGGCAAGAACACCCGCTTCAGCATGCTCAACAACTACGTTCATTCA
ACATCGGGACGCTCGCCCAAGATCGGTGGCGACAGCAGCGCCAACGTCGTCGCGCACATCGCCAACAACTACTGGGCGGACAACTCGGGCCACTCGTTCG
AGATCGGCGTCAACGCATGGGTGCTCGCCGAGGGCAACTACTTCCAGGACACGACGCTGCCGCTGCTGACCGGCTCGGATGGCGCCCTCTACGCCGCCAC
CGCCACCACCGAGTGCAACAGCTACCTCGGTCGCTCCTGCGCCGCCAACGTGGTAGACAACAGCGGAGCGTTTCAGTCCCGCAACGGTGCGACGGCTCTA
TCCACGGCAAAGTCGTACTCGGCCATCTCCAGCTACAGTCCGAGCGCGGCGAAGAAGCACAGCAAGACCACCAACAACTTCGGCATCGGCGTGCTCAACT
AAGGTGGCGATGCGCTAGAGTGAAGAAGCATCGCATACACACTACCAGTAGATGTACATGTATTTTGTTTTCTGTAGGCACCGTAGCCGTGCAAAAGTCG
CTGTCGTACAGTTTCAACAACTAAGTCAATACCAACAGCCTCATCGTTCAAGACGTACATCGCGATAACTTCGTCGTGATGACCGTGGCTCACCTTTGTG
TCTTTGTGCGGTTCGTTTTTGATGCAATAGACTGTAGCATCCTTGTGTTGGACCTGACCTCTACATCGTGGTCTTCCTTTTGAAACACACATCAAAGCAA
ATGGATTCGTACAGAAAAATGCTTCAAGCTTGTTGAAGTGCAGTTTGATAGTTGCTCCGTTGCTGCCAGCAGCAACTTGCTGGTGACCCAGGTCTCCCAA
TGAATCTTCGCGCGTGTCGTCGTCATGGATGCCGGTCAAAACATCCTACGCTTTTGGCACCTTCATACGACGTGATCGCCAACAATGCAGCTGGTAACAG
CTCATGCAAAACCTCTCTTTGCTATGGAGGCACACACGGCGTACAAACTCGGAGTCCTCTACCGGCCGCCTAGGTGTGCAGTAGTTATAATAGCACTTTC
GATTCTGATCGTCTCGACTCTTTTGCCATGAAGCTGTTCTCGATCCTCGTTCTCCTACTGCTCGGCGCTGGTCTCGTCAACGGGTATGCCAACCCCAAGC
TGTGCACCGGAACCTGCACCAACGCCCACGACCCGTCCATTATTCGGCGCGATGATGGCACCTATTTCCGCTTCTCCACGGGCAACAAGATCGCCATCCA
CTCGGCCCCGGCGTTGACGGGCCCATGGACGTATCTCGGAGCTGCAGTGCCCACTGGCTCGAAGATTAATTTGACGGGCAAGGATGATCTCTGGGTGAGT
GTGTTCGTTGTCCCTGGATGTTATCCTACTGATAGTGACCCACTCGTTCTGTTTTGTAGGCCCCAGACGTGCACAAGGTTGGCGACCTGTACTACTTGTA
CTACTCGGTGAGCTCCTTCGGAACTCAAAATTCTGCCGTCGGCCTCACCCGGTCCACGACAATGGAGGCAGGCTCGTGGACCGATCTTGGCAGCATTGGC
GTCACGAGCGACTCGTCTAAGAAGTACAACGCCATCGATCCGAACCTGTTCCAGGTTGGCAGCCAGTACTTCCTCAATTTCAGCAGCTACTGGCAGGACA
TCTACCAGGTGAAGATGAAGTCAACTCCGACGAAAACCGGTGGGGCAGCGGCGTATCAAATGGCGTTCACATCCAACTACGAGGTGGTCGAGGCTGCATA
CATGTTCTCGTACAACGGCTACTACTATCTCTTCTTCTCGAAGGGCACTTGCTGTGGCTACGACACGTCACGACCTGCCACGGGGAAGGAGTACCGTATC
CTCGTGTGCCGCTCAAAGCATGCTACGTCCGGGTTTGTTGACAAGAACGGCAACGACTGTACGAACAACGGCGGCACGGTTGTGCTCGAGTCTCATAGCT
ACGTCTACGGACCAGGAGGCCAGGGGGTGTACAATGACCCCAAGTACGGCCCCGTGCTGTACTACCACTACGGCAAGCCGCGCTTCATTTACCTTTGTTG
TCCTATTATCACTGACGGCTTTCCTGACTGTTTGGTGCAGTGGACACCCGGATTAGGTATGCGGATGGAGACAAGAAATTCGGTTGGAACCAGCTCGACT
TCTCCAGCGGCTGGCCCACCGTCTAAGCACTCTCAGAGGAGCGAGGAGGGGTCGTCGATGCAGTGTGTCATGAATAGGGTAGAAACCATTCCTATGTTGA
TGGTAATTTTCTTCGGAAGGCCCCTGTTTTGGGAGAACGCTCTTGGGGTTAACTAGCACATGCATGTACCAGGCAGTTGCTACGCCTACGATTCACTGCA
TGTATGAAGAATCTACATGCACCATAAGCTTACGCCAAATTTGTGTCATCCTGACTGACATGCGAACAACGAGAACGCGTTGACAAGTCGTCGCGACAAA
TACTTGATCGCTCCTGTGCCGTGGCATTCCCTACGGGTGCATTGTCGTGCCGTCAGGCGGAGACTTTGTGTGTGCCAACCGGGATTCAGGAAGAAATGGA
TTCTTGTCAAGATAGGCATTTCAGTGGGGTCCAAGCAAACGCTGCCGATATTTGCATTAGCGCTTTACTACTATTAGAAAGGATTTAGAACCGTTATAAA
GTCGTATTGCCTGCAACTTGTGAATAGAATTCGCTCAATACTACACCTACACTGAAAGCTATGCGCCTCAGAGCTCGTGGTCCAGGTTGCCAATGCGTCT
CGATTCTCGGATGGAGCCGATAATGTTTACCATACACTTGATACGTTTGGGTCCTTGACTCAAGGCTTGAGCACTTCCAGCAAATCCATACAATGCTAAT
CCCAGCCGGGACCCTAGATTCATCTGGCGGGTACGCCACGCCACAGTCAGAACATACGAAACGTCGGTGAAAAGTCAACACAACGGTAAAGGCACAGCCT
GATGGTGGACTGTGCTGTTCGAACGGTGTGGCGTGTCAACGGCCCAACAAGAAGAGCTCTTCACTTTCAATTTTGACAGCACCAATAACGAAGCCGTGCC
TACTTAAAAGCATGAAGGTGCTCTCTATTCTCGTCGGACTTCCTCTCCTCGTTGCTGGCCTCGTCAACGGATACACCAATCCTCTAACGTGCACCGGCAC
CTGTACCAATGCCCACGATCCGTCCATTATCCGTCGCGATGATGGCACGTACTTCCGCTTCTCCACGGGTAACAAGATTGCTATCCACTCTGCTCCAGAC
CTGACGGGTCCTTGGAAGTACCTTGGAGCAGCAGTCCCGGATGGCTCCAAGATCAATTTGGCCGGCAAGGATGACCTCTGGGTGAGTATTTAATCGCCTT
GTCACTCCCAATGGTGCTATTTGTTAACGGTCTCGTTCGTCGACTAGGCTCCTGATGTCACCAAGGTGGGCGACATGTACTACCTGTACTACTCAGTTAG
CTCTTTCGGAACTCAAAATTCTGCCATCGGCCTCACCAGGTCCAAGACCATGGAAGCGGGCACGTGGACTGACGCAGGCAGTGTGGGTATCACGAGTGAC
TCGTCCAAGAAGTACAACGCTATTGACCCAAACCTGTTCAAGGTTGGCAGTCAGTACTACCTCAATTTCGGTAGCTACTGGCAGGACCTTTTCCAAGCCA
AGATGAAGTCGACTCCTACGAAGAACTCGGGTGAAACCGCGACCCAGTTGGCCTTCACCTCCAACTACGAGGTTATGGAGGCCGCGTACGAGTTCTCGTA
CAACGGCTACTACTATCTCTTCTTCTCGCAGGGGTCGTGCTGTGGGTACGACAAGACCCGCCCGGCCAAGGGTAAAGAGTACCGCATTCTCGCGTGCCGC
TCGAAGAGTGCGACGTCAGGTTTTGTCGACAAGAACGGAAACGATTGTCGTAACAACGGCGGTACCGTTGTGCTCGAGTCTCACGACTGGGTCTACGGAC
CAGGAGGCCAGGGGGTGTACAATGACCCCAAGTACGGGCCCGTGCTGTACTACCACTACGGTAAGCTGCTCTCACTTTGTTCGTCTGTATGTACGCTGTC
ACCATTATCTAACACCATGTTCATTGTAACCTTGACGCGCACGCAGTGGACACTCGAGTTGGATACGGCGATGGCGACAAGCGCTTTGGCTGGAACAAAC
TCGACTTCTCGAGTGGCTGGCCTAAGGTGTAAACTCTCCGTGCCAATGTGCAAGAGTGATAGAAGGAGGAGATGTCTGTGTTACGCCAAACCCAGATTCC
TGCTTGGAACGGCGTGTGATCCAGTGCGTTCTTACAAATATATGTGGATGAAGACGATAAACTAGTATCCGAAGTTTGGAGCACACACTTCAAAGTATTC
ATGGCTCTGTGCTTAATTTATTTTGAAGTGAGGATGTCATTTAGTCAATCCTAGCGCCACCTAGTGCTCGTGCCCAAGACCTCTGTGCTTGTCGTGCACC
GAGGGCTCGCTTGTGATTGTTTAGCTGCAAGTTTACGACGACAGGTTGATATAGCGAGGCCACAGCGGCGGTTGCTGCTCGCAACAATCGACGCGCGAAA
ACGTGCTCGAACACTTGCGATGCAACACAAAATCAAAATGACTTGCGGCAATGCCCATGGCGATTGCACGAAGCAGCTCCTAAGAGCAATCCAGAATAAT
CAGCGGATATGTTTTCGAGGTTGACTCATTTAGCGATGCAACACAAAATCAAAATGACTTGCGGCAGTGCTCATGGCGATTGCACGAAACAGCTCCTAAG
AGCAATCCAGACTAATCAATGGCCACCAAAGGTGCGCTGGTAGTTGTGATGCACTGCGTAGTCTGAATCATGCTACGAAATCTGGTGGCAAGAATCCGTT
CCAGCCTGCTTCGCTGCAGCGTGCCTCGCGTGTCAGTCGAGTTGCGGACTTGACAGTACTGTACATCTCGGAAGTATTTTATAAGCCTACATTTTGATGT
GTCCGAGTTGAAGCAAATCCGCACTTTGCTGCCTGGAATCGGTACACATGCACTATAATAGTATATTGTACGAAGTGTAGCTCTGTATAGATTCCTGTTG
TCCATCGATTGTGGATCACTGCATTCTGATGGGCCAAGGTATGAGTCAATAAGATCACTTGCGTCGCAATCGCAGACTCCAGCTGGGATAGCCTTGTAGA
GCTGTTTGAGCCGTATAATTCTGCAGCGAGTCCATTGTGCCTTGCATTTTCGCATTTGACCGTAAGCACCACCTGAGCAATCATGAAGCTTCTCTTGATG
CTCGTCGGACTCCCGCTTCTTGTAGCTGGGCTCGTCAACGGATACGCCAACCCCCAAACGTGCACAGGCGTTTGCACCAACGCCCACGATCCATCCATTA
TCCGCCGCGATGACGGCACGTACTTCCGTTTCTCCACCGGCAACAAAATTGCTATTCACTCTGCCCCAGCACTCACGGGCCCGTGGAAGTATCTGGGTGC
CGCTGTTCCGGATGGCTCGAAGATCAATCTCAAGGGCAACGACGACCTATGGGTAAGTTCATGAGACTTGTTTTCAATAATATTTATGCAGTACTGACAA
AGTTGTTCCGCTAGGCCCCCGAAGTGAACAAAATCGGAGACACGTACTACCTGTACTACTCAGTTAGTTCGTTTGGCACCCAGAGCTCTGCTATCGGTCT
CACCCAATCCAAGACAATGGAGGCGGGGTCGTGGGTGGATGCCGGTAGCGTGGGTGTTACGAGTGATTCGTCCAAGCCGTACAATGCCATCGACCCCAAC
CTCATTAAAGTAGGAAGCCAGTACTATCTCAACTTTGGCAGCTATTGGCAGGGTCTTCACCAGACGAAGATGGCGTCGCTACCGGCAAAGAGCTCTGGCG
AAACCGCAAACCAAATCGCCTTCACCTCGAACTTTGAAGTTGTTGAGGCAGCTTTCGAGTTCGCCCACAGCGGCTACTACTACCTCTTTTTCTCCAAGGG
TTCGTGCTGCAAGTACGATCAGACTCGCCCAGCCAAGGGCAAGGAGTACCGAATTCTTGTGTGCCGCTCCAAGAGCCCTACATCGGGTTTCGTCGACAAG
AATGGAGTTGACTGCCGAAACAACGGCGGATCGATCGTTCTTGAGTCGCACGACTGGGTTTACGGCCCAGGAGGCCAAGGAGTGTTCAATGACCCGAAGC
ACGGCCCCGTGTTGTACTACCACTACGGTAAGCAAACTTCTTCAGTGCTTTTGATTATGATTATCTTTTGTTGGCTAACGGTTTTGAATGTTTAACACTA
TGATCTTGCAGTGGACACTCGCATCGGCTACGCGGACGGTGACAAGCGCTTCGGCTGGAACCAACTCGACTTCTCAAGCGGCTGGCCCACTGTCTAA