Transcript Name :
Phyra_g8
Orientation:
(+)
Number of Exons:
7
Description :
ABG66533.1 reverse transcriptase, partial [Phytophthora sojae
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
fprintscan predictionP-Valprediction_id
Ubiquitin0.000000000000027PR00348
Ubiquitin0.000000000000027PR00348
Ubiquitin0.000000000000027PR00348
Profile scan predictionP-Valprediction_id
Reverse transcriptase9.921PS50878
Ubiquitin domain22.112PS50053
HmmSmart predictionP-Valprediction_id
Ubiquitin domain2.3e-17SM00213
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
UbiquitinIPR019956
*** None ***
InsideOutsideTMhelix
1-827
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
protein bindingGO:0005515IEA
RNA bindingGO:0003723IEA
RNA-dependent DNA replicationGO:0006278IEA
*** None ***
*** None ***
Sequence
        14427 bases(100 bases per row)
ATGGATCGCAGTGAGTTTCCTCACTTGAACGACTCGCAGTTCGAGTCCGTTCGGAAGATGGCGGGCATCTTCGGGATGGATGCCCTCCAGAGCTTGGCGG
CAGCAACACCTGCCGAGCAGCTCGAGCGCGTAAGCGCTTTCGACACGTACGAGCAAGGGCTAATCGCCCATGTACGTGGGAGCCTACAGGCCCCTGTGGC
TGAACGGAAACCAGTTCAGCCCAAGCCTTTGAGGCTGAAGGTTAACCCCTACGAAGGAAGGAAGGGGAAAACCTTCACTTCTGGGTCCGAGAGGTCGAGC
TCGCTATGGACGCGGCTCTCGTCTCGGACGAGCGACTCCGCGTCGCTTTTGCTCTCTCCCACCTTAGTGGTCGAGCAAAGAGCTGGGCGTATACGCGCGA
AGCGACAACGCCTGGATGCTTTGCATCCTGGGCTCAGCTGTGTGACAGCTTCGAGCCGCCTTCCTCCCGGCGAACTATGAGTACCGCCAGCGCTCACGCT
TCCTTGCGTGCAAGCAAGGGAGACGTGAGCTGCACGAGTACATCCAGGAGATGCGGGAGCTCACCGCATCTCTGGTGGGAAACCCACTCCATAACACACG
GTGTTCATGGACGGCCTGCGAGTAGGCCCAGCGCGCACGCAGCTGTTTCGGGTGCAAGCAAGCACCCTGGAAGAAGCGATTCAAATCGCTCTTCAGGAGG
AGTACAGCCATCGACAGGCTCGCACTCCTGCCACTGCGTGGCTTGGGGCTCCACTCAGGGCGGGCCCCAAAGTAGAGGCCCCTTCAACGGTCCTGTGCCG
ATGGACCTGAGCCTTGCCGAACAGCACGACATTCGCTGTTTCGGCTGTGGCAAACTGGGCACATGAAACGTGCGTGCCCCGCGGGAGGAACAACACGGCG
GTTTCCTCCCAAGCCCTTTGGTCCTAGGGGTCGCTGGCAAAAGCCGCGACCCCGTGGCCAGGGGAACGCAGGGAACCAGTAGGGGCGGGGCGCCCTACTG
GGGAAGATCTAAGTCTTCATGAGTGGTGCGCGGGTGGTGCGCACCATGAAGGCTTAGCCCCTGAGAGTCTCTGTACTCTCGAAGCGGAGAAGGGCAGCGG
AGGGCTGCTTGTAGTACATGCAAGTGTACGGGGATACGATCATCCCATGAGAATCTTGATCGATTCTGGGGCGTCAAAGAACTTTGCACGCCGCCGGACG
GTCGCTCGCAAGAGCGACCAGTTCACCGATGCTTTACGAGAAAGCAAAGGGAACGGGCATGTCCTAGTCAGACTGGCTGACGGGACTGTAGTGGAGGTGC
CCAAGGTCTTTATGGACCTGTCCGTCAAGTTTGAGGACTTTAATTCCACTGAACGATTCCTCGTTCTTGATATGGACAAGTACGACTTGATCCTGGGCAT
GCCATGGCTTGAGAAGCATGAGCCCTGGATAGACTGGCGCGGCAAAGCCATCGGGGCTAGCCGGCCTGCTGCTACTGACAGAGCATTGGTGAGTCATGTT
CCCACCTCTGTCAGCAGCCGGGCCTACCACCGGAGCCGAGTCGGAAATGACTCCGAAGAATTAGTTGCGGCAGGAGCCGCAACAGGTGTCATGACACCGT
CCACGCGGGCAACGGACCGCCACAGGCAATGCCGGTGGACAGGACGTCGAGTCCAGCGAGGGGAACTGCAATGCCAGCAGTACCCACCGCTCCTGACTAT
GGCACCGTACGGCCTTCGGCCTTATCGACGCCGGGGAAAGTCAACTCCCCAAGGGAAACGAGCCCACGTGAGACCAAGGAGGTCGAGACCGTGGCCAGGG
TCGAGGTTGCTGGGAGCACCTCTGGTGTGGGTAACAATGTGCCACACGGAGTCGATGGAACTCCCGACTCCACCCTTGAGTCACCACCGGCTGTGGGTAA
CAAAGGACCATGCCGTGGTGGGCATCGACGACGTCGTCGCCGCCGTAAGCCGAGTCTGTGAGACAGACTGGAGTCGCTACAAGCGACTCGGAGAGAGAGA
ACTCTCCTCAGGCACGGCCGGCCGAAGAATGCTATCACTTCTTCGACGGCGAGACCGGGTGTACGGTCAAGGCGGCTCCACAACGTTGGCAGCCCTGCCT
GAGGTGTCAGAGCTACTGAACCTCGAGGAAATGTCGATGGACGATTTCCTGGCACAACTGAAAGCCGGGCAATCGCGGAGATGGTGCTCCTGAAGCCGGA
GGCCTCTCCAGAAGAGCTGAGCTCCTCTTCCGTTATGGACAAGGATGTCCTGGACGAGCTTGGCAAGAAGCGCGCAACGCGCACGGGCTCTGCGATCCTC
GAGAACCCCAAGGATCCAGTGTATCCTTTGGTGAAGGAGTTCTCGGACGTGGTGTCCAAGGACCCGCCGTCCCAACTCCCACCTGACCGAGGAGTTAGGC
ACGAGATTGATCTCGTGCCAGGCACAAAGTACTGTGTGACCAGGCAATGGCCACTGCCTCGCGAACAGTGCGAGGTCATTGATGCCTTCTTCGCCGCGAA
GGCAAAGGCAGGCATGGTGCGTGAGTCGAAGTCTCCGCACTCGACGCCCACCTTCTGCGTTCGCAAGCCGAACGGGAAGTGGCGTCTGGTTCATGCTTAT
AACAAGCTGAACAGCGCAACGGTGCCCGCCCAGACACCCATTCCCCGCAAGGATGTGTTGTTGAACAACATGGCGGGCTGCGAGCTTTATAGCGCGCTGG
ATCTGGTGGATGGATACTACCAGATCCTGATGCGCGAGCGCGACATCCCGCTCACGGCGGTGAGCACCCCGAGCGGCATGCTCTGGGAGTGGCTAGTGAT
GCCACAGGGCCTATCAAATGCCCCAGCGACTTTCAATCGCTTGGTCACACAGTTGTTTAGACCCTTGCGTGCGTTCACGCAGACGTACTTTGACGATATC
TTCGTCCATAGCCGTGCCGGGGAAGGCAAGACGGCTATCGAGGTGCATCTCGAGCACCTCCGTCGAGTGTTTATGGTCATGAGAGCAAACAAGCTCTATG
CCAACATCGACAAGTGCGTCTTTGCGGCACAAGAGATCAAAGTTCTCGGCTGCTTCGTCAGCAGCGTCGGCGTTCGAGCCGACCCTGAGAAGGTCAAGGC
CATTGCGGCCTGGCCCACACCACGATCCCAAAAGGATCTTCGCAAGTGGTTGGGTCTCGCCAACTACTTGCACAAGTATAGTGCGGGGTATGCCGGGCTG
GCACGACCCCTGTCGGATCTCCTTAAGAAGGATGCCGACTGGCGCTGGGAGAGCCGTCATCAGGATGCATTCAACAGCATCAAGGCGAGCTTGCAGCGCG
CGCCGGTCCTGGCTTTGCCGGACGAGACAAAACCGTTCAGCGTTGTCTGCGACGCCTCCGACTATGCCATCGGTTGCGCGCTGCTGCAACACGACGCGGA
CGGGCACGAGCGAGTCATCTCGTTCCAGTCCAGGCAGCTTAAAGCCGCCGAGAGGAACTACCCTGTCCATGACAAGGAGCTCCTCGCAATGAAGTATGCC
CTTGTCAAGTTCCGGGTACACCTCCTGGGCTCTGAGCCCTTTGTGATCTATACAGACCACGCGTCCTTGCGGACGGCCACCAACTCTCCGCATCTGTCTC
AGAGGATGGCCCGCTGGCTGTCATTCTTCGCGGAATATAACTTCCGCGTCGAATACAAGCCGGGCAAGCTGAACGTGCTTGCCGACGCGTTATCCGTCGA
CCCGACTATGAGCTCGCGCACATTAGTCGGGTTACGACAGATCTGTACGATCGGATACGCCTGGCGTATCGATGATGAGAATCTCTCTCCCCATCGTGCG
GTTCCTCACCGCTGGCAAGGAGGCCAAGCTGCATGGCTAACGCCCCGCCATCGTGCCCGCCTCCATCGCTATGCGTGGGTCGATGGCCTCCTCCACTACC
GCGTGGATCCGGCCGATCCTCCGCGGATAGTCGTCCCCAACGACGAGGATCTGAAGTATGACATACTTCAGGAGGCGCATGATGTGCCTTCCAGCGGCCA
CCTTGGCCGCGAAAAGACCTTCTTGTCAGTCTCCCAGGTCTTCTGGTGGGCCCACATGTACAAGTGGGTCGCCACGTATGTAAGGACCTGCGAGACATGC
CAGCGAGTGAAACCTGCTGGTCATGCCTCGGCTCCTTTGCAGAGCCTGCCAGTCCCGGAAGACTGCTGGAAGTCGATGAGTCTTGACTTCGTCTTCGGAC
TGCCGGCTGATGCCCAGGGCAACACCGGCGTCCTGGTGTTTGTCTGCCGCTTGAGCAAGATGGTACACCTTGCTCCGGTGGCTGACTCAGTCACCGGTGA
ACAGACTGCACGGCTGTTCCTGGATGGCGTCTTCCGCTATCATGGCCTCCCTGAGACTATTGTCTCTGACCGTGACCCACGGTTCACGTCTGCGTTTTGG
AAAACGCTGTTCCAATTGCTTGGAACACGGCTGCTCATGTCCACGGCCGACCACGCAGACGGACGGCCAGACGGAGCGCGTCAATCGCGTCCTCGAAGAC
ACTCTACGCAGTGTCTGTGCCGAATCTCCCGGCACATGGTCGGCCAGTTTGCCGATGGTTGAGTTTGCACTCAACAACGCGGTACACGCGTCCACGGGGT
TCTCCCCGTTCTACCTCAACGGGCTCCGGAACCCCCTGGTGCCACTCACTCTCCGTGGTGACACCGCGGCTTCGGTCGTAAGTGGGGGAGAGGCTCGGAA
AGCTCTTTCCTCCCAGGTGTCAGACGTGACACCGGCTTCCCTAAAGAAGCAGTTGTCGACTTTTGTCGACAACAGGCTTAATGTGATAAGCCGGGTGCGC
GACACAATGGCCGCCGCCCAAGATAAACAAAAGGAGTACTCTGACCGACATGGAAGAGGAAACTTAAACGTGTTTAAAGTGGGCGAGTTAGTCCTACTCG
ACACTAGGAACCTACCACTAAACTCGGTCAGTTCCGTGCTCAGCAATAAGCTGAAGCACAGGTTTATCGGACCCTTTGAGGTCCTGAGCAGGCATGGCTC
CGCCTACACGATCGACTTGCCTAAGTCGATGACCCACCCGACGTTTTATGTGGGTCGTCTGAAGCGCTACCACGACCCTCAGGCTTCTGATCCCCCGCAG
GAAGCGAAAGGGGATTCTGAGGTGGCGAGTTCACCACCTCGAACCGAGCGCCGCCTCCCGCTGTGGCGACCGCCACGCGGAAGCCGGCGCAGGGGACTGG
TCGTAGGCGTAAGCCTGTGACCTCGAAGACGCCCCGCCGTACGGGTAGGAACCGTAGTACGGCTGGGAGTACGCATAGGACTGCGGCTCCCGATAGCCCG
GATAGCTCGGCCGGTTCTGGATCTCAGAACGGAGGTGAGCCACCTCGTCGCGAAGACAGTCGACGTCGTACGACGACACGACGATCGACCCGGGAGTGGA
GATCCCCACACTCCTGGCTCAGTCGGTCCACATCCCCACGAAGGAGGGGAAGAGACCCCGGCTTTCCCGACTGAGCGGCAGCCTGCCCACCAGGGCCGAG
ACCCAATGCGATCTCCAGAGTGTACACTCGATCACGGAGATCGTGGATCTCCTGCTGCTGAAGCAGCACGGACTGATCGGGAGATCGCGCCGACGATCTC
GGAGCCTCACGCGTGGCGGAGCCTCGTACGCATAGTCGAGCAAGGCCTCCGCCGGCCCTCCTCGACCGTAATGGGGAAACCCACTACCACGTGGAGCGCG
TGCTCCGTGAGCGGCGCCGCCAAAGGAAGCGCCAGCTCTTGGTGAAGTGGCGAGGGTATCCCTCGTCACAGAACTCATGGGAGCCGATCGAGCGGCTCCA
GGCTGACTGCCCGAAGGCTGTCGCGATCTGGGAACAGAAGCAGCGACAGCTTCGTAAGTAGTCCGCGGCTTCTTAGCTGACGGACGGGGTACGGTGGCAG
ACGCATGAACACCGTACCCGCGCTCATTTCGAGCGCCGGACTGAGCTCTACGCTTCAGTCCTTCCATCTGGAGTACAGCTTCCGCTTACTCACGAGGTGG
GCAAACCGAATCCGGAGGTCGCGCTGATCGAGGATTCGATGCAGCAGCGATCCTCCTTGAGCTCATCGAGCTCCTGGCGGAATGCCCACGCAGGCCAACC
CACCGCCAGAACAGGTCCTCTTGGGCCACGGTGTAAGTGTTCTCGGGTTGGACCCAAGGGTAACCCCACACCGGGTGGAGACCACCCCTGTTCTCACCCT
TCTTGCGAAGGGTGGTGAACTCCTTGAGCGGCATCCGATGCGGAGCCAGGAAACGCACCGAGCGGCCTCAATATCCTCGGTGAACAAGTCCACCTTTTGA
ATCAAGTCGCGCTCGTACGCGCCTCGGGAGGTGGGGCCTCCAATGCGGCCACGAGGGGCGACGAGCCTCTCAAGGAACAACGGAGAACCCGTGTTCTCAT
CGGGCGGGAAGTAGCCCTGGTGTGCTTGGGCTCCCTCTCTCCCGAAGCACCCCCGCCAGGAGTTGGTTGCGGCGCGGAGGCGGAGGCGCTGGCGCGCCTC
CTGGAGGCGTTCTGCTGCTCGTCGAGCGCATTAGCGACCTCCTCCGGGACATGTACCTGTCCCTCTTCATCCTCCGAGTTTGACTCCGAGGAGTCAAACA
GGGACTTGATAACATCAAGCCCTCTAGTCCGGCCCTTGGGAGGGGACCGAGAAGCGATTCGCTTCTTCGACCCGGCCTCTTTGGCCTTGGCATCACGGGC
TCGCTGGAGACCCTCGCCGAGCGTCAAGCGCTTGGCTGGCGACGCTGCCTTAGCGTCGCCGTCCTTCTGGCCACCCGCGGCGCTGGCATTCGTGGACCAG
TGTCCGCAGGAGACTTGGCACGTTGTCCCCATCTCCACTCAGGTCCCCATGGACCGAGGACACGTCCTCAGACGCGCCTTTGTGACTTGGCGCGTCACCT
TCGTCGTGTGAGACTGCTCCAGGAGAGGAGCAGTGCTCAAGGTCGCTCGGCGACCCGGGACTTCGGTCCCGATGTACAAACCGAGGGTTTGGACGGTCGT
CCGGTGGTACATCGGGCGAACCACGGCGTCGCGAGCGCGTTCGCAGACGCGGATACGGACGCGTCGCCAGGCGAATAATCGCCTGGGAAGCCGCATCAAC
GGCTTCCCCCAACGCGGAGGCCTTGCCGCGAGGCTTGGCCGATTTAGACTTCAGGGCTTAGTCCTGGACGCTTTCGCGTCGCGAGGTGTCTTCCTCTGAG
GCATCGTGCCAGGCCGACGTGGAGGCCAGGGAGCACGTTTGGGAATGCCCCAGTGCTCCGGAAGAGCGGAGAGCGCGAGCGGAAACGCTCGGCCTCTTGT
CGATGGTTATCGACTGAGCGAGGAAGTAAGAGAAACTTCCCGCTCGCCCCGATTGGTCGATAAGATCGAGTCTAAGTGGGGGAGGATGTAACGGGGTTAC
CTGAAGAGTGCCCGTCACTCTTCCGAGTTGGGTACATGGTGTACCCAACATCACTGACACGTGGTGGTGGCTCACAGCCACCCATACATAAAACATATAG
GATAAACTATAGTTGACTTAGGAATTGTATTGCAAGACGATCTCTAGGTAACTAACTATAAATATATCAGTCTATAAACTACGTTGTCTAAGTCAACCGT
TCCCCAAGACCGGGAACTAGTGAACCGCCGTTCACTTGGAGTTTGTATACTCCTAACACTTCCTCAAGCGCAAGGTGCTGTGTGACTCCCGTCACATATA
AAGACAACCCCAATATAGAACAACTCGGTCCTGATACAAGATCCGAAATTATAAAGTCGATTTCACGAAAATAATATAACCTCGAGTTTATATATAGGCA
ATATATTAGCGTACGTACCAGAAAGATTAAAGAGATTGAATATTCAAGCTACCAAGTGGGGTAGCAGCTACCGCGTCAAAGTGATGGTAAGATGGTTATA
TGTTAGTAATATGTCACGCCCAATCAATCAAAGACTGGTTGCGAAGGAGTACAATGTCCATTGATACTCTTAAGAAGTATATGTCGCCAGACTACATTTG
CGAAGTAGGAGGACAACCGAAGACGAGGCACTTGCTTGCAAGAGAGTAAAACTCAAAGTGATTCATTCAAAGCTCATGCCTGCAATGCATGCCTTCAATA
CGTGCCGTGCACAAGGAGGAAAGCATCAGCCTAAAAACCCTTTTGAAGGCTGACCCAAGTACCATTTTTACAATGGTAATCATATGGAATCTCACCTATA
TGAGGGAATTGAGCCATCTGTTTTCTATGGCAAGCTAGAGAACGTTCTTTCTACTCAAGTGAGTTCGTTCAAGGTAAATATTGCTCTCGGATACGAACTT
GAAAGTAATGTCGATGTAGCTATTGTTAAGGTCATTGGATATCCAGTTTTATATGGACGAGTATTGCTGAAATCGAGCATATGTTTAACAGTTTGCGAGT
TCCACACTGATACCGAGGATTGTTTCCAATCGATTTGAAAGAGAGCTTGTGATAATGACGATGCACTATTTAGAGAAATGCTCTGGGCATTTTCCGAATA
TACGAGACTGAGCAATGGATAACAGATATTGGAACTGATTGTACTGCAAGTACTTGCTAATACTAAACCAGCACTATCTGACTATCTGAGGCTCTGTAAC
TGCGTGTTCAGGGTCGATCCCCACCACTGGACGTTGCTGCTCGTTGATGACTGACTTCCTGGCGAGCCAAGTCCCATCGTGAGCCCATTAGCGACTAGAT
TTGAATTAATCTTAGATGAAGCTCCAAAGTAAGCGCCTCCCAAACATTGAATCGCCCCAGTACTTGAACTAGTTGATGCAGCTGTACCCAAATGGAGAGA
GTACCGGAGATATTTACACTACCACTTACATCCAATTCACTCGCTGGTGTGGTTGTTTTCACACCCAACGAAGCCATTACCGCCGACTACAAGCCTATTC
AAGCCGTTCGTGCCAAGTGATAGATAGCTATTATTAGAGTTAGATGAATCCCACATATAGTTGATGCGGCCATTAGTTGCAGTTGAACGCCCAAGCAGCA
AATGACATATGCTGCCAGTTGATAGTGAAGGCATTGCGAGTAGTGCTATCCGTCCATTGGTTCCACTAGCTGAAACATTTAATGACGTCATAGATAGAAA
TATTAATACCACTGAGATTGGATAACCTATCAAGCACTAGAGCTTTAGAGGCGGCTGCTATGCCTGCTGCAATCCCTGAGAGAGACTGAACTAGACTGAT
ATCGTACGTGGTTCCTGATTGGCGGTATTGGGTAGCATCGACATATGCAGAGGCACCCGTGATGCTCAATACTGATGATGCACCGCTCAATGACAGTGAG
CCAGCGAACCGGCCTCCGCCATTTACATCTAATTTTGTCTCCGGGGCGTTAGTGCCGATCCCAATATTGCTATTATTGCAAATGACTAGCTGATAATCAT
TCAAATTTGTGGCAATGCAGAGATACTGGCTAGACGGCGTGGCGCTATTGTTATACGCGATATATGATCCATCATGAATAGATGCAGATCGACCGATTCT
AATAACGATATTACCATTCGATGCCAAGTTTGGCTGGACTACATTGAGGAGATTGACGGAAGCGGTTCCGGAATTAGAGATATTCAGCGATTGAAGAGTA
CCTATGCTTGTTATATTCGGCTGAGCTGCTGTCTGTAGAGTACCTGTAAGGCTGGTTGCTGACAGAGAGCCGATACCAGAGATATTGCTCGAGCTATCAA
GCACTAGAGCTTTAGAGGGAGCAGCGGTGCCTGGCGTAATGCTTAGGACATACGATGGTGAGGCCGATACGGATGATCCATTCACAGTCAGCTCAACGCA
CCAATGCCACTAATATCACCGGCAGCTCCTGGAATAAGGGCAACACCAGGTGTCGCTGCCCCTTGGATAATTCCAGTGATGTATGTGAGTCGATAATCGT
TTTTATCGAGATATAGAGTTTGTGCGTAATCGTAGGTGAGGAAACCGCTTGCATCCAGCGTGAGATAGAATGCAGGGGTTTAGATCGGTGGGGGATAGCT
AAAAATCCGTGTATGTTTGTTTTGTCTCAAGCTATATAGATAAAGCTATTTTCAATCTTTTGAGTACGATTCCAGATTTCGGAGCTTCACTCCCGAAAAA
GTTCAAATCAGCATCCATGGGTGATATCCCTGCGCTTGATATCAAATCGCTATTTAGAATGGTTGTGTTGGGTCCATCGTTCATATATATATACTTCCTC
AATAGGCTTGTTCTTGTATTTTCCAAAAGTAAGTTCGAACGACATGGTCTGTTAGTGGTATCTATATACATACCCCTTTAATTTTTTTGAGAAAAAAATA
ATAAATGTAAAACTATCGGCATAATGTTCTACTTCAAGTATTTTTTTTATTCTTGTGACATCCAAGGTATCAAAAAACGTTGCGTCTACTAACGTGAAAA
ACTTCACTTGAATTATTGGTTCGCACGGTTTGCTCTACGTCGAGCTCTAGCTCTTTCAGCACGGTGCCATTCGGCATGAGCAGCATGTTCACCATACGTT
CGCAATCGTACACCACAAGCTGGAACACAACACACGAGATCAACTTCTTCTTCCGATGACGATCCGGATTCCTGGTCCAACACAGCGTCCAAATCTTCAC
AATTAACAGTGAAGCCAGGAAGAATGGTACCACCATCAAGATCTCTCCACGCGCTATTGCCAACGCGTCGAACAAGACAATTTCCTCGGGCGCATCGCTT
GTATTCGCACATGATTTTGTTCTTTGGATCAATGAGCCATCCCAATTGCACACCGTGAGGGAAGTACTCGTGCCGCATCTTGTGATCGAGAGCACCAAGC
TTGGAATGTGAACCAGTGAGAGTGTCGATTTCCACCACGAACGTCGGAGCAAAAGGTTCTCCACCACGAGTCCATCGTTGAGCTTCGGTCAGCTGCCTTG
CATCATCTCGAGGCACATACGCCACATCGGGGACCCGAAGCGTTGTGCCATCCAGCACGTATTCATCTAGCGCATTTGTCACTCTTCCACCATGGCCACT
CCACGCAGCCCAATTCAGCAGCGCCTTGCAGATGCATGGTCCGATTACGCTGCGCCCAAACACCACCATCCGAAATGGAATAAATCGGCCTTCGTCGACG
AAGAAACCAGGCTGCTCGCCAAGTATTGGATGGACCAACGGACCGAACTCTTCACGTGCTGGTTTAACTGCTCGAGGGACACACCAGCGTAGTCCTTGAC
ACGGCACAGAGTCTTCTTCGACTCTAGGTCACGCACCAGTCGCGCAAGCACGTCTTCGTGGTCTTTCTTCTTGCCGTTTGCTGCGGTCATGGTTGCCGAT
GCTGTTCTTCCTCGCACTGGCAGAAGCAAACAAGAAAGACCTTGCCCAGTGTGGTCCACGCTACGAATGAATTGACTTCAAATTGAATTGGTACTTCCAC
TAAAAAAATGATCAATTCAAATTTGATTCATCAGTGACGGTTCCGAGAACTAGTTCCATACCCAGGAACCGATAGGTAACCGCGGCATAATCCGACGCAT
AATCATGTCGGCAGACCTCCGATCCTCCACGTTGCTGTTTAAATGGCCCGGAAAGTCGGAAAGTGGGCAATTCGCGCTCCACTGGAGGCCAAGTTGCCCG
ACATTTGACTTTCCGAGCCAAACAAACAGCAGCCAAAATAATATTTGGGCAGTGTCACGATGCACTCATCACCTAGCCCTAATGGATATTCGCGCGCTCT
TTCTTATCGTGCTCTCGCTTCTCCATCCGTGAGACCCGAACGAACGTATTGTAGTTCCAGCTCCAGGTCCTCATATTCACATCGTAGCTCACGTTTTCCC
GATTCGAGCGCGCCATTTAGACGCAGCAGTTCCGATACACGAGCTTGAATTGTCTCCAGCTGGCGCAGTAGGTCTTCATTAAGCGTTTTCGCTTCACGAA
GTTCTGTTTGCAGCCGGGTTTCCTTCTCCCTGGGCCCTGACGCCTTTGTCGCCGCCTCAAGCTGACCCATGAGTAAGCGCTCACGAGTTTCCAGCGCGTC
TACCCGGCTCTTTAGCCGGCCAACCTCGCTTTGATTGCCACGTTGCTGCTTAAGCTCAAGTAGCGGTAGTTGAGTCTGCTTGTCTTCCAAATCTTTCTCC
AGTTGCTTTCGGCGCTGCTGTTCGACCAATATCTCGTCTTCCAATGAATCTAAACGCTTCCGGAAAGCCTCCCACTTCGTGTTTCGCGCGGTCCAGTCAC
GCTCTTTCACTTGCCCGATCGCATTCTCGAGAATTTGGACTTTATCGCTTGACTTTTCACGAACTGTAGATAGCTCCTGGGCCTTTTCTCCATCTCCAGC
TCAAGTCGCTGATTTTTCAGGAGTGTTTGTTGTTGCGTCTCCGTTACTAGGTCGTACTGCACAAGGAATTGCTGGTAGGTCGTCTTGATCTGCATCAACT
GATGCTGGAGCTCGCCTACAATTGCGTGATCTTCTGAGGAAGCCATCAAATCACGAAGTCGTTCCTCCTGCTGCTCTAGCTGCCCCACCTCGTTAATTCT
CTCGTACAACAGCGCGTTCTCATTTCGAAGCTCATTGTCATCTCCAGAACGTCCTCTGAGCGGTGGCAACTGCACTAACTCGTCAGAATCGACTACAGCC
TTTCGATCAGCTACTTCAAGCGTCTTCACGCGCTCCGTTTGCGCCTGTAGCTCGTTCTCAAGTTGATCTATCCGGTCGTGGGGGATATCTGAATCGCAAC
CGGTTTCCCCACTTGTATTTCCTGCACCACTTCTTGCACTCTTTTCGGCTTGAAGAACCATGAGACTATGCTGTGTCTTGGTTAATCGTGCTGGTAGTTC
ATACATCGCTAAGTACTTGGCATGCATTTCTGCGTAACTTTCACCCAGTGCGTTGTACTTCTTCAGCACGCCAGTCATTGCACGTTGTTGCTGATCAGCA
AATTCACGAAGCACGCTCTTCTCCAGAGTTTTTTCCATGCGGTCAATCATCTCGTCGGCACCCTGCTTCCACGTCTCTAGGTACAAGACTCGATACTTAT
GAATCTGTTCCGAGTCGTGCAACTCGCCCAGACTGGATATTGGCTGGGTTCCAGCTCGTGGGTGGGGTTTCCTTACGCAGTGAGTGATCGCTCCCTAACA
GCCATTCATAGCCAAAGAATGATGCACGATTTTATCATTGCTGTTCCAGCATTCCACCGCCGTCTCAACATTGTACATTCATTTAATGAATGCATTTGTG
TTGGAGAATGCAATCCAACAAGGACCAATGCAATTGTTGCACCATGCATAATTAATTATGCGCTGTGAGGACGCTGAAACCACAGGCTCGAATGGCTATA
CCTGCTCTAAGAGTTCACACTGACCCAAGTTCCGCAATTGAAATGCCCCGCTTCGACGACAGGTTACCATTCGTTCCCGGGGGTGGACTGGTAGTCTGTC
GACCGCTACATAGTGATTCGCACTCGCTATTGTAATGAAACACGATCATTTACATACCCTAGATTCGCGTTCGAGAAGACTGCAAGGCGGAGAAAGAAGA
TGTTTTGAAGCAGACAGCGATCACCAGTACTTTCAGCGGATTTTAGTGTCAAATTCACCAATGCCCGAGAGTACGACAAGTCTGACATCCAGAGGCGATA
CGTGAATGTCGGCTATTGTTTGATGAACTTTCGTGTTCACAAAGTGTAGGAAAGTGTAATGCACTTGCGAGGGGGGGTGCTGCTCAGTCCATACATTGGT
AAGGTCTGTCCGTGCAGCTCTCTCAAGTCTAACTGCACGCGTTGTCCTGCAGCCTGCACGCACTTCAACATTGTTCTCATGAACGCAGCATCCGCAGAGG
TGACAAGATGCCCTTCGGGGAATAATGGGTTAAGTGTCAAATTTTACTATCAGATGAAATATAAGTGGGCCAATTATCACCAATTGTTTTTACTTTCACG
AATTTCCCAATTCGAATTTCCGCGAAGAACTTTGCGGAACCACAGCCACTTTTGCCTCGAAACACTCAGCCGCCAAGTTAGAAGCCAAGATGCAGATCCA
GATCAAGGTACCCCACGCCCCCACGCCGCGATCACAGGGGCTGGAAGGGTACTAATAAGTGTGTTTATTGCGCTGGTGTAGACGCTCACTGGCCGGAAGC
AGACGTTCAACTTTGAGCCGGACAACACGGTACGATGCGATATTCTGGCGCTTCGGACGGTGTGATACTGACGTTGTTTCTCCTTCCGTGAACAGATCCT
GCATGTGAAGCAGGCCCTGCAGGAGAAAGAAGGTATCCAGGTGGACCAGATTCGTCTCATCTACAGTGGCAAGCAGCTGTACGTGGAGTTAGTCTTGAAA
CGATGAGCTAGACACGGATGTTGATGGCCTTGCTGCTCTACAGAGCCGATGACAAAACGTTGCAGGACTACAACGTGGCTGCGGGCGGCACCATCCATAT
GGTGCTGCAGCTGCGTGGCGGGTGCTA