Transcript Name :
Phyra_g16
Orientation:
(-)
Number of Exons:
2
Description :
OWY97572.1 Deoxyhypusine hydroxylase [Phytophthora megakarya
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
HmmSmart predictionP-Valprediction_id
PBS lyase HEAT-like repeat640SM00567
PBS lyase HEAT-like repeat0.01SM00567
PBS lyase HEAT-like repeat0.0000013SM00567
PBS lyase HEAT-like repeat1.5SM00567
PBS lyase HEAT-like repeat0.26SM00567
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
PBS lyase HEAT-like repeatIPR004155
*** None ***
InsideOutsideTMhelix
1-295
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        937 bases(100 bases per row)
TGCCATCGCACTCGTCCGTGACCGAGACAATCGCGTCCCAGCCCGTGCCCGACACGACGCCAAGCTTCGAGAGGCTGCGCGATGCGCTGCTGGACCTGTC
GGAGCCCGTCGGCAAGCGCACGCGCGCCATCTTCTACCTGCGCTCGCGTGGCGGCCTCGAGGACCTGCAGGTGCTGTTACAAGCGCTGTTGAACCGCGAG
GATTCGGAGCTCATGCGCCACGAACTGGCCTACGTGATCGGCCAGTTTCAGCGGGAGGAAGCCTGCGACACGCTGCACCGCGTGCTGTCGGACGAGCTCG
ACGACGGAATGGTGCGTCATGAGGCGGCGGAGGCGCTGGGCGCCATCGGCGCGGCCCAGTCGCTGCCCATCCTCGAGCAGTTCAGCACTGACTCGGCGCC
CGAGGTCTCGGACACTTGCAAGCTGGCAGTAGACCTGGTCAAGTACAAGTTGGCTAAGGCCCAGGGAAAGGTCGCCGAGGGAGAGGTAGACCGCAACCCG
TACCTGTCCGAGGACCCGGCTCCTGCCGCCGAGAAGGACGTGACCACCGCTGAGCTGCGCAAAGTGCTGCTGGACCACGACGGCGACATGTTCGCCAAGT
ACCGCGCCATGTTCTCGCTGCGGAACCGCAACACGGAGGAGGCGGCGCTGGCGCTGGCCGAGGCCTTCAGCGACCCGAACGCACTCTTCAAGCACGAGGT
GGCGTACGTCATGGGTCAGATGGAGAACCCCGTGCTCGTGCCGGCGCTCAAGAAGGTGCTGCTGGATGACAGTGAGCACGCATGGTGCGGCACGAGGCGG
CCGAGGCGCTGGGGGCCATTGGCACGACCGAGTGCGAGGACATCCTCAAGCAGTACCTCAAGGATGACGTCCAGGTCGTGCGGGAGAGCTGCGAGGTGGC
ACTCGACATCATGGACTACTGGGCGCCCAGCAAGTAA