Transcript Name :
Phyra_g17
Orientation:
(-)
Number of Exons:
2
Description :
POM78506.1 Hypothetical protein PHPALM_3960 [Phytophthora palmivora var. palmivora
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-25
26-48
49-84
85-104
105-463
*** None ***
PositionContextScore
54VRHRRRR|RT0.57
57RRRRRTR|QL0.504
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        1985 bases(100 bases per row)
TGGCATTGCGAACGTCGCTCGGCAGCAATGCGCACACGCTCGGGGACTCATGCATCGACCTGTACGCCGAGAAGGTCATGATCCCTCGGATCTCGCTCTT
GTCGCTACTCGCGGGGCTCTCGGTGCTCACGACGCTGCTAGTTCGTCACCGTCGACGCCGACGCACTCGCCAATTGGCAAAGCTGCTGCCCGGCAAAGTC
GTCGTTGAGACGTCGACAGCTCCCGAGGACGAGCTTACCACCCGCAAGCGCTGGTTCGCGTGCTTCTTGGCCACGACCGTGGCGTGGATCACCATTTTTC
TATGGAGTTTCCACGCGTCCACGGCGATGACGACCACATCCGCGAGTGGGGCGCAGGGACGACCCCGCATTGTATTCAGCTTTACGACAACTCCGCGAGG
AATCGACGAGATGAAGCCGACGCTGGACGCTCTAGTGCAACAGGAGGGGGACGGATTCGACGCGGTTTACGTGATCGTCCCGAGGACGTATCGAGACAAG
GAGGTGGCCATCCCGACGTGGCTGGTGGACGATGCGTCCACATTGAACCGCACCGAGTTCCGCGGCATCGCGTTTGCTACCGGGGCGAGTCCGTACCACG
ACAAGTTGAGGCTCATTGTGCTGGACACGGACTTTGGTCCAGCCAGCAAAGTGCTGGGAACCCTTTTGGTGGAGCAGGACCCGGAGACCATTATCGTGTA
TGGTGACGACGACCGCGTCTACCCAGCGCAGCTGTGCGAACGTGCACTGCACTACACGCACAAGTTCCCGAGCGACGCAATCGCGGTTCTCGGTGGGTGG
ATTTCGGCGGAGGACGGACTGTACTGCGGGCGTAGTCTGGCAGTAGGAGTCAACAGTGTTTCGTTTGTGGGGGGAGCTGGGGGAGTTGCCGTCAAGAGGA
AGTTTTTCGGGCTTGGAGAAGAGATCATGCCGGCATTTGAGGTCACCAACATGTCCAAGGCGTGTTTCCTGGGTGACGACTATTATCTGTCCCATTTGCT
GAGCAGGAACGGCGTCCGTCGACGGATCGTGTCCGATAGCTGCTGGAACATCGAGGCGCTGACGGAATCGTTCTCTCATGGTGGACTATCGTACGCACCG
TCGGAGCACCCGGGAGGAGCGAACGTCGAGCACTATCAGCAGTGCATTCGCGAACTGGGCAAGGAGCACGACCTGTCTCATGACGGCGAGTTCGGGTCGA
CTTATATGTTCCTCTTCTCTCGTACTTGGGGGGTGCTTCGAGGTCTACGGAATTTTTACTTCAGAGGTGAATTCGTGTCATGCTGATGGAGGTCACACCT
GTACAATAGACTTTCAAAAAGAATATATGAGCCGGCGTGACAATAGCTGATGGTGCTAATCTACAATACCTGGCATCATCCGATAGCGTTGGCCAACCAG
AAGAATGTGATCTCGAACTCGTGGAGGGAAACTCCACGTACTGTGATCTCGCAAGTTTCCCGGCCAAGAGTTCAAGTGTCTGTGTTCGTGAACAACTCAT
GACCACTTGCCACTCTCCAAATTGCAGTAACAAGATCACCTCAGCGCTCTACAGATGAGTCCTCGCCTGGCTGTATTCGCGCTCTTCTCTATGGTTGTCA
TGATCGCTTGCAGCGTACAGTATGCAGTCGCGATGGAAGGCGAGCTCCGGCTCTACAAGGAGCCAGAATTCAGACGACTACGACGTCTCATGCGTGTTTC
GACTAGCAACCTCTGCTACGACATGCCGTGCGCGTATCTCAACACGATCATTTCGTCTGCAAGATGGTCGGGACTACCGACGACTGGAGCAACGTTCGCG
GATGGCAGATCAAAATCGCCTTCTACGCGGGCAGCAACTGCACGGGTAAAGTCGTCGCCGTGAACACGAACGTCGGACAAGTCGACAATTTTGCAAAGTT
CGGGATGGACAACGCTACCGCGTCATTCGCGGTGCTGGAGACGTCAACGACGATGCAGCACGAGTCGAGCAACATTTGCGAGTGA