Transcript Name :
Phyra_g9
Orientation:
(-)
Number of Exons:
3
Description :
hypothetical protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
fprintscan predictionP-Valprediction_id
Peptidase C12, ubiquitin carboxyl-terminal hydrolase 10.0000052PR00707
Peptidase C12, ubiquitin carboxyl-terminal hydrolase 10.0000052PR00707
Peptidase C12, ubiquitin carboxyl-terminal hydrolase 10.0000052PR00707
Peptidase C12, ubiquitin carboxyl-terminal hydrolase 10.0000052PR00707
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-4
5-27
28-77
78-100
101-205
206-223
224-227
228-250
251-684
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
obsolete ubiquitin thiolesterase activityGO:0004221IEA
intracellularGO:0005622IEA
ubiquitin-dependent protein catabolic processGO:0006511IEA
*** None ***
*** None ***
Sequence
        5342 bases(100 bases per row)
TGAAGTTCAACGTCTTCCTCCTCGCCGTCATCGCCATGCTCGGTATGATCACCGCTGCTACTGTCGACCAAGGTGCCGTCAAGACTCCCGCGGAAGCGCT
GGAGAAGATTCAGGCCTCTGACTTGCCTGCTGGTGTCACGCTCACGGGGACGACCGAGAAGATAGACCCACCTGCTTCCGCTTCAGCTGTCGCTATGAAG
GAATCCGACAAGGATGACAAAAAGGAGCAATTCGGCTGGGGCGTCGGTGGTCTCGGTCTCGGTCTCGGTCTTGGTGGTGGCTGGGGGCTTGGTGGTTGGG
GAGGGTGGGGTGGCTGGGGAGGCTACGGACCCTACCGCTTCGGCTTCATGTGCGGCGGCTACCCTGGCTGGGCGTACCCGATGGGCTACTGAACATGTAT
GGTGCTGGTCTGTACGGCGGCGGCTGCGGTCTGGGCATCCCATTCGGCGGTCTCTACTACTGCTAAGTTTTGGAGAGAAGGCTGCTGTCAGCCAGTCGAC
ATTGAACAACTGATGGGATCATTCTTTAAGAGTGCGGTTTATCGCTTCGCTTCACGTTTTGCTAAGCCCATGAAATAAGCAACACCCACTTTCTTTCTTG
CCTACGACTTTAATGTACGAGAAGTACGTCGTGAAGGCATACACAAGGTGATGCATTCTAGTTTGATCTCATTTTGATCTACAATTTCCATTTGGGACCC
AGAACGAAGCCGTCTACTCTTTCTACATGTATTATATGATACTTGCTATGTACTAAATGCAAGACAATACCTGTCTGGCAGGCATTCCAGAAGAAATATT
GGAGCAGTGCGGTTTGAACGCAGAATATTAAAAAAAGACTATTGGTATTTTCATAAGAAATAGTATTATTTTAGCAAACTCTAGACGCTTCTCATATTTT
ATGTCGATAGTGCAAACAAACTGATATGATATGTTGGAGACGGGGTCTCTTCATGTACCGCATTCAGCTCCAACGCTGTCTACGATGGCGTTCTATTTTT
CTAAAGTGAACAATGAACCCTTGTAGTATTTGATAACTTGGAAGCGAGTAAATTCAAGCCTCAAGCTGACCAAATGGTTTATTGTTGCGCTATCGTGTTC
AGTTATTTGGATGGCGTGGATTGCACGAGCTACCTTTTTATCTTCATGCTTCCAAATGCCATCGCAAGATTAAACTGTTGAATGAGTGAGCACAGAAGAC
GCTTCGTTGCTGTTGTTACCATAGTCGAGGAGGTACCCCGTGAACACAATTGTCTCGACGGGGATGCAGTATAGTCCGTTGTACTTCATGTAGTCAAAGC
CCTCACAATTGTAAAGCATTTTCTTGAAAGGAGGGAGTGAGTGGCGAGACAGTTTTATTTACCAATGGTGGACGATTATCGCCGGCAAGAACGCAAGCTC
AGAGACGCTTCGTTGTTACCATAGTTGGCGTACCCCGTGGACAAAACTGTCTCGACGGTGATGCGGTATTTTCCGTTGTACTTTACGTACGAAGAAATAG
GAGAGAGTGCCGAGACACGTTTTAATATTAATGGTGAATTTGGGGTTTCAAGTGCTGGATCGATTTCCGTTAATTAAAACTTACCTCAGAGACTTCACTA
CGAGCGACGACGTCACGGCAGCAGCCCCTAGCATCATAGACGCAAAGAAAATAATAATAGGTATGATAAAGGCGCAGTATTATTGTGCATCAAGCTCCCA
GATCTTTCGCAAAATTTGAACGTTCATCTTAATGGTTAATTCGAGCGGTGCGCTCCAACGATGTGTGAACTGTATTTTGGGAGCGAGCTCAAAGAGGGTA
TACCTCCTTTTATATCGCGCTCTTTCGCAAGAAACTCACCTCGCAAGCACCAAGAACTTGATGCGCTTTTTGGGGGCTCTATAGTCTCTAGGTAAACACG
AACAGAGGACCTCATTAACCCCCCCCAAAAAAAAAAAAAAAAACTTGATGCGTTTTCGTAGCTCCAATTACCTTTGCTTCCATTTTGCGATCTACTCATC
CAAACTCATTAGTAATTTTTGGGTGGCGTTTGATTAATCCACCCGCTGTACGGTAAATCCCCACTTCCTGAACTAAACACATTGCGACTCAAAGAAATTG
GTAAATTACGCAGGTCTGCGATCCCATATTATATTTTCTTGAAACCTTTCGCGGTTTGATTTTTGGTGGATCTAGTGTTGGGGTCTTTGTAGGAAAGAAG
TAAGTGTAATTGTAGCAATGAAACGCACCAAGTACTTGGTTACTTCGCAGTAGTTTCCTGCGACAGAGCTCGATGTTTCAGCGTCCGCCCCCAAAATACT
GTTCATGTAGAATCAACTTCACCTCAGGTGAGTTTGGAAACGTTCCAGGAAACTCAGCTCAGCCAAGTGTTATTAAGTCTGGACGCATACTCCGATACAA
GTGCGCTTGGCCCCACTCATTTCATGTCACGCTTCAACCTTCAGTTTTCATTTCGTGGTTTACTGAGCAGACGCCACGCGAAACTCGCCTACAACACCCG
CAGCGATCGAGAGATGAGTATCGTGACTCCTGTCGATGTTGCGGTTGCTGTTGGTGAAAACGACCCAGGGTCGCCACTGAAGACGTACACGTTCTACAAC
GTAAAGGGGCGCGACGGCAAACTCGCCACAGAGATTTCAGTTACCTTTAACAACGACTGGGCTCCATATTGGACGGATGATCGTCGTGTGTGCCCACCCC
CGCCGGACCCGACGCTGTTCACCACGATAATGGGCATTATCTGCTTACCAATTGCCCTCGTGTTGCAGCTTGCCAAATACATCGTCATGGGCATTTTCGC
GATCGTTGCCGGTATTTTGTCGGTGCTCTGGATGCCAGTCACTGCTGTCAAGAATGCGTGGCGGTACGGCAAAGCGCCGCCAGTACTCACCCTCGATGAA
TTTCATTACTGGCTGGGTCGGAAAGGGTTTACCAATGAGGAGATGAAGAAGGTGAAGGAAGCGACCAACGGCATGACGATGCACACACTTGCACGCACAC
TGACTGATGTGCGGGATGTGGAGAAGCTATTCAAGTTGCAGTCGATCGAAAAGCAAAAGTTGGTGGTCGGCATACTTCAACAGTCCAAGGAGGCAATTGA
CAAGGCACATGAAAGCAAGTTTCAGGAACTCCGGAAACGGTACACAGGCGCGATCTTCAGCTGGGGGGCCGAAGACGCTTACAGACTAGGCGACGCGATT
GCCAAGAACGGGCGAATGTGCAGTCGAGGTGAAGACGCTCGCAAAAAAGCAGACTGGCAACAACGGGTTGCCTCCAAAGTCAACTTGCGAGTCAACGCAA
TCTTGCGCTGCATCAACACGATTGCGAACGAAGGTCGTTTCTCCTCGAACGACGCGAAAATGAGTGACCTGGAGCGGACTGTGAATCGATCCGATAACCC
ACCGGATTGGAACGAGTTTGTGGTCGACAACAAAAAACATGACAACAAGTTGTTCGACGAAATTCACACTGCAGCACCTTACATCAAGCAGTACATTGCG
CAGGCAATTGTCACCGAATCGTACGCCAGGCGAGTAGCACGTATTTGCTGGAGCTGGACAGTTTTGTTGGTGCTTGTCGCCTTCCGGCTGGCCAAAGTGG
TCCTTAGATTCGAATTCGATGAAATTGGCGATGTGATCGACCTCATTGTCGGCACGGTGACTGAACTCGCTGAATCTCCAATGGATGCCTTGGACATTCT
CGAAAATGGACTGCCGACAGGCAGCGGAGGTACTGGCACCGACGGGAATGGTTTGGGAGGCTCGATAATGAACGTGGTTGACGACAGATTCGGCCGGGAC
GCACGCCTCGAAAACAAGGAAGCGCAGATGAAGGCATCAATGAAGTGTGAAAAGGTGACCGAGCTCGTCGAGGAATAGAGACCCGCAGTCTCGCCATCGA
ACGGTAATTAGGATTCGAACAAGCTTCAGCAGTCCAATGCATCTGAACTTCGCAGTCTAGACTGACTTGAGGAAAAACATTATAATCGATTTCTATTCAG
CAAGCATTTGTCCTGTGTTTTCAACATGCGGTTTAGCGAAACGTTTGTCGGTCGAAGGCTACATTCGTTATCCCTGGATAGATTGAGTGACGTTTTTCGT
GACCAGGGCCATATCTCGAGAATAGGCAGCACAGCCGCAATCTCAATCTGAATGGCGCAAATGAGACGCAACAGCGTTAAACGTCAAACCCCAGACTCAA
TAACAACGGTGTTGGTCGGGAAAACTGCACCACAAAGAATATCATGACTTCAACGTCAATATTTCAGTTATTGTTCGAATCCACCGTTACGAACCTGCTT
CAGTGATCTTTTTGACCGGAAACACAAAAATGTCGTGGTGTACCATCGAGTCCGACCCCGGTGCGTCTCTTGTTGCCCCCCCAATCCACCGGCCACGCTA
ACCCCATCCTCCACTGTAGGTGTGTTCACCGCTCTCATCGAGGACATCGGCGTCCAGGGCGTCCAGGTGGAGGAGCTCTACTCGCTGGACGAGCAGCAGT
TCGCCGCCCTGTCGCCAGTCTACGGCCTCGTGTTTCTCTTCAAGTACGAGGCCAAACACGGGGAGGAGGCCGATCCCCCGGTCTTCGCCTCAGAGGAGGA
CGGACTGTTCTTTGCCAAGCAGGTGATCAGCAACGCCTGCGCTACGCAGGCCATCCTGTCCATCCTGCTTAACTGCCAGGGCCTCGAGCTGGGCGAGACG
CTGACCGAGTTCAAGGCCTTCACGAGCGACTTCCCGTCCGAGTTCAAGGGCCTCGCTATCTCCAACAGCGACAAAATCCGCCTCGCCCACAATTCTTTCG
CCAGGGCCGAGCCGTTCGTCGTGGAGGAGAGAAAAGCAGCCACGGAAGACGATGACGTGTACCATTTCGTGGCCTACGTGCCTGTGAACGGCAAGGTCTA
CGAGCTGGATGGCCTGCGAGATGGACCGATCTGTCTGGGGGGCGTTCCAGAAGGAGACAACCGTGAAGCGTGGCTGCAGGTGGCGTGCCCCGTTATCCAG
AAGAGGATCGAGAAGTACGCGGCCTCGGAGATCCGCTTCAATCTTCTGGCGCTCGTACGCAACCGGATACAAGCGTTCGAAGAGCAGCTTGGAGCACTCA
TTGAAGCTGGTGGTAGTGAAGAGCTGGCCGCGCAGATCCAGGCGGACCTGGCCGCAGAGCAGCAGAAGCGAAATGACTGGGCGCTGGAGAACAGGCGTCG
CAAGCACAACTACATCCCGTTCATTGTTCAGCTGCTCAAGACGCTGGCGGAGAAGAAGCAGTTGGAACCGCTGACCAAGCAGCAGCTCGACGCCCGCAAA
GCCGCTGCTGCGAATACCACGAAGCCTACGAACGCGCAGTAA