Transcript Name :
Phyra_g27
Orientation:
(-)
Number of Exons:
4
Description :
ABG66535.1 reverse transcriptase, partial [Phytophthora ramorum
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Reverse transcriptase13.242PS50878
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-350
NN-scoreoddsWeighted Score
0.7212.3290.005
PositionContextScore
13SWKRFAR|DL0.694
TypeScore
nuclear39.1
GO
Biological ProcessGO IDPrediction Method
RNA bindingGO:0003723IEA
RNA-dependent DNA replicationGO:0006278IEA
*** None ***
*** None ***
Sequence
        1305 bases(100 bases per row)
TGTCGCTCCCAGTCACAAGCTGGAAGCGTTTCGCTCGCGACCTGCACGATGGACGCATCGAGCAGATCTGCATCTTCTCGGATGTCGAGAGGATGACGTG
TGCAGCGGAAGAGCTGAAGCAGCTCATCACTGAGGGCGCGGAGACCCTCAGCGCGAAGTCGAAGAAGGAACGGTTCGACGAGCAAGGCTGGGACTCGCTC
AAATCGAGTCCCTTTTACAATGTCTTGCGTGAGTACAAGGATGTACTCCCGGGCGACATTCCTGCGGAGTTACCGCAGGACAAGGGTGTTCAGCACGAGA
TTGATCTCGTGCCGGGAACGAAGTATTGCGTTACGCGACAGTGACCACTGCCGCGTGAGCAAGTCAAGGCAATCGACGACTTCTTTGAACGTCGTCGCAA
GGCAGGACAAGGGTGGAAATCTAAGTCCCCGCACAGCGCGCCCACGTTATGTGTGAAGAAACCACAGGGCGGGTGGCGCATCGTTCATGCTTACAATAAG
CTAAACGATGCGACGGTACCGGTGCAGACGCCGATACCTCGAAAAGATGTGATCATCGATTCGATGACCTCGAGTATTATCTTCAGTACTCTTGATCTGA
GAGACGGGTTCTATCAGATCCTCATGCGTGAGAGCGATATCCCTCTCACAGCGGTAAGCACTCCGAGCGGTATGCTCTGGGAGTGGCTCGTTATGCCGCA
GGGTCTGAAGAACGCCCCAGCGACGTTCAACAGGTGCGTCACGCACTTGTTGCGCTCGGTGCGCGACTTCGCACCGAGCTATTTCGACGACGTGTTCATT
CACAGCCGGGCTGTGAATGGGAAATCGGATGTGGAGATGCATACAGAGCATCTCCGCAAGCTGCTTGAGCTCATGCGAAAGCACAAGCTCTACGCGAACC
TGAAGAAGTGTATCTTCGGGGCGACCGAGATACCCGTACTTGGGTGTCTCGTGGGGAAGAACGGCGTACGCCCTGACCCAGGAAAGGTCAGTGTGATTAA
TGAATGACCTACGCCTTCAAACGTAAAGGAGCTGCGGCAGTTCCTTGGACTCGCCACGTACTTGTGCAAGTACGTGAGCAACTACGCGAGCAAGATTCGC
CCGCTGTCGGAGCTCTTGAAGAAAGAAGCTGCATGGGAATGGACTGCTGATTGTCAGCAGGCATTTGAAGCAGTCAAGCAGGGCTTGGCTGAGGCGATCT
TGGCGTTAGCCGACCAAGATCGCCCATTCCACGTTGTGTGTGCCGCGTCCAATTTCGCGATCGGATTCACACTGATGCAAAGGTCGTGACCGTGGCTGTG
AATGA