Transcript Name :
Phyra_g11
Orientation:
(+)
Number of Exons:
2
Description :
XP_008911276.1 hypothetical protein PPTG_15730 [Phytophthora parasitica INRA-310
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Ubiquitin domain11.05PS50053
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-180
181-203
204-221
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
protein bindingGO:0005515IEA
*** None ***
*** None ***
Sequence
        1788 bases(100 bases per row)
ATGGAGAAATTATTCGCCTTGTCCAGGGAGCTGTGCGCGCTCAATGCGCTCGGAACGTGCATGCTCTCGCGAGCTCAATTCATGCTGCTCATCACGAGGG
AGTTCCCATTGTGTGATGCCAAGCACGTGAATCGCTTGTATTCGTCGTACGACTGGCAAATCCGTGACTCAGTAGATGCTCGATTCGTTCTTGGGACGAT
GAGAGCAATGCGTGTGCAACAAGGTGAGCCGATAGAGCTCATCTGCAACACGCTCCGTGATTTTGACGACACCACCGCCGCCAACACAAAACTTTCAGAT
GACAAAGCTGTGGTCTCGAACGGTGTTTGTTTAGCGAAGGCTCTGTCGCTTTGTTGTACCAGTGATGAGGAAGAGCGCGAAATGGAGAGCAGAGCCGACC
TCATTTGGACCAAACACTTGCCTGGCAACGACAAATTCTGTCGCGACGTCTGCGCGGCGGTGTCCGACTCAATGTTTGGAAAGCATCAGGGATGTCGCTT
TCGCGGGTCTCAAGCTCTGATAATTGCAGCCAAGATGCCGGCGTAGCGAGCAAAGTAAGAGACTGTGAGACCAAGGAAGACGATGGCGAGGAGGACGTAG
AGGACAGCAAGGAGAACTTCCTGAGCTCAGCCAACTAGTAGATGAATCTCGCGTACCTGTGCGGCGTATCCGTGAGGCTCTCAAACGAGAGCGAGAGACG
CTGACAATCTTCACTCAACAACTTCTCCAACGCAGGCACGAGTGTCTTGTTGGTGCCAGCACGAGTTCTCCGAGGCAGTAATCTCACGTGTTTTGGTTTC
ACGAATCAACATCCTTTGCATCTTTTTATTCACGTCTCGACGATTGATCTTTGCAAAGAGAAGGAGGCTATGATCGATAACTGCGTTGATTATTAGCATG
ACGACATTGTCCGTGCAGTTTTCATGCGCATTTATCACTTAGATTTACCTGCCGACGTCATGAGCCTCGAACACGAAATACGGCGCCGACACCATAATCT
GCATGCGTAGTACGGAGTTGCCGAGTGTGCGAGGTGAACACAACCGGTGTCTACATTGAACACACCTGCGAAATCTCCCAACGTAGGAGAAAGCAGCACA
CAACCATGCTCGTTGCCGCAACATAGCAACTTCAATCACTTCGAGCGCAACATAAGTTACAGCAAACACTAGCTGTTACGGTTCCTAATGGCACTAATCA
CAAAGAGTGACGACACGTCAAGAAAAAATCTGCTTGAAACTGGCAGGAAGCGTGCGGGTGGTCGCCATTTCAAGGTCAAAGTCTCACTTGGCGTCGGCAA
GACTTACCGAACGAGAAGTTCCATATCCACACACAAGATGCAGCTCTTTATCCGCTCGGTGCGTGGGCAGCAGCGACTTGTTGTGCCCGACGCGAATCCC
CTGACAAAATGAAAAACGTCCGTCTGTGACGTTTGCAGGATGCAGGACGAACGCTCACCGTAGCGGTGGCCGACCCGCGGGCCAAAGTTTGTGAGCTGCT
GTCGCTCGTGGAGGCCAAGCAGCAGCAAAGCAGTCGCTCCGACCAGTACCTGAACTACGGGGGCGTGCCGCTGCGCGCGTCGCGGTCGCTCACTGACTAC
GGCATCCAGAACCACGCGACGCTGGACCTGTCGCGACGACTGCGCGGCGGCTGCTTCGGCTTCTCCATCATGTTGTGGATCCTCATCTTCATCTGCTGCT
TGGTCAGCGTCTGCACATGCGGCCTGTCACTACCAGTGGCGCTTTGTCTGCTGCCTCCTGCACTGCTACTGCCGCTCTGCTGTCTTTA