Transcript Name :
Phypl_g1456
Orientation:
(-)
Number of Exons:
9
Description :
hypothetical protein PHYSODRAFT_554382
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
HmmSmart predictionP-Valprediction_id
MIT0.0048SM00745
AAA+ ATPase domain3.7SM00382
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
MITIPR007330
*** None ***
InsideOutsideTMhelix
1-410
NN-scoreoddsWeighted Score
0.6522.3220.005
*** None ***
TypeScore
cytoplasmic522
GO
Biological ProcessGO IDPrediction Method
nucleotide bindingGO:0000166IEA
*** None ***
*** None ***
Sequence
        1833 bases(100 bases per row)
ATGTTCTTGTGGCGCGCTCGTCGCCCCGAGGACGGGATCCAGAAGGCCATTgaggcggccgtggcggcgGACAAGGCAGGGAAATACACGGAGGCGGTGG
ATCTCTATGCGTTGGGCatcgagaagatgatggcgcagctggcgcgTACGTTGAAGCGGGGAATATCCACCCGGACGGACTCGTTGTGATGATGTTGCGC
GACTTTATTTGAGTGCAGAGCTGCCGaacgaggaggccaagacgcAGATGCGGCACAAGATCAACGAGTAcatgctgcgcgccgagtACCTCAAGGACTG
GACGGCGGAGCAggcgcgcaagcagcaggcgcaggtgGGCTATGACCGGATTTTGGAGAAATGCTCGTGGTTATGGAGCGTTCTGACGGATATTTTGGGT
GTACGCTGCGTAGGACGTCTCAGTGTCCAGTGCACAGGAGAGCAATGCTCGTACGGCTAGTGATCGCCAGGTTGGGAGGTTGCAGACGGCACGTTGCAGT
AGATAGTGGAGGAGATTAATGTTGCCATGCTGGGTTTGCTGCTTTTGACAGCAACAAAGAGCAGGATACTCGAAGCAGCATACAGAGCATGCTCATACGA
TtctggacgaggtgctggaccacTCACCTAGAGTGCACTGGACGGATATTGCTGGACTGGAAGTTGCAAAGCAGATTTTGCAGGTCTGCTGTCTTGCTAA
CGCGCCGAATGAGTTGGTGAGACTGACTGTTATATGCTGTGTAAGTAGGAGGCTGTCATTTTGCCCACACTGCGCCCGGACTTATTCACGGGGTTAAGAG
CGCCACCTCGCggtgtgctgctgttcggaCCGCCAGGCACAGGTGACGGATGCATGAAGTAGGTGGAGATAGCATGACGGTTGCGAACTGATATTGGTTC
AACTTTTGCTGCTGGGATAGGAAAAACGTTGCTGGCAAAAGCTGTAGCCACGGAGGCCAAGGCAACTTTCTTCAAGTACGTCCGTGCTTGGAGATGatgc
ttttgctgcttgacTGGTTACCATACTTACGGTTGTTTGCGGTAGCATTTCTGCGTCATCTTTAACGTCCAAGTGGGTGGGCGAGGGCGAGAAGCTGGTT
AGGGCGCTCTTCGAGATGGCCCGAGAACTGCAACCGTCCGTGGTTTTTATGGATGAGATCGATGCTTTGCTGTCGACAAGATCAGCGTCCGAGAACGAGG
CCAGCAGAAGAATCAAGAACCAGGTACGATTTGAAGCATTGCCAGCTACTTGAACTATAGCACATTAAGCTGACTGTTTTTACGACTGCTGTTGCAGTTT
TTCACCGAGCttgatggagctgcgtcaTCACAAGAAGACCGAATTCTCGTCATGGGAGCAACGAATCTTCCtcaggagctcgacgaagccATCGTACGCC
GCCTGGAGAAGCGCATTTATGGTACGCCACTTGGAATGGGAAATATGGCACACGAGTATCTAAATGGGGCACCTTGCGAATGTCGTTTTGTTTGTTGGCA
GTGCCTCTCCCCGATGATACTTCTCGTGAACGCCTTATCCGGCATCTACTTGGTAGTCAGAAATTCTCCCTGTCATCCAAAGATATCAAGCACGTCGTGA
AGGCAACCGAAGGGTACTCAGGCAGCGATCTCAAGGCTGTATGCAAGGATGCTGCTCTGGGTCCGATCCGCGAGCTTGGAGCAAAATTAGCTAACGTAAA
GGCTGAAGATGTGCGAGCAATCAACGCATCCGACTTTCAGGTGGCGCTCTCGCGCGTCCGTCCAAGCGTGTCCTCTACGACGATAGAGGCTCTGGTCGCG
TGGAATGCACAATTCGGAGTGTCTGCAGTATGA