Transcript Name :
Phypl_g1454
Orientation:
(-)
Number of Exons:
2
Description :
pyruvate dehydrogenase E1 component subunit alpha
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-403
*** None ***
*** None ***
*** None ***
GO
*** None ***
KO ID
K00161
K00161
K00161
K00161
K00161
K00161
K00161
*** None ***
Sequence
        1289 bases(100 bases per row)
ATGATGATGCTCCGCCGCTccaccgccgcgctggcccgcgccgccgcgcccgcctcgcgcgccttcagcgccgccgccaacgcgtCGGGCGAGGCCAAGT
TCGACTTCTCCACGCCCTTCCAGCTGCACCGTACGTCGGCAACAGATCGCAGCCACAGGATCCTGGACTTGGTATCTGACGCAGTGATGGTCGTTTCCTA
TACGCAGGTCTCGAGGAGGGCCCGGCCGAGTTCGCCGTGACCAACCGCGAGGAGATGCTGAGCTACTACACGCTCATGTACACGATGCGCCGCATGGAGA
TCACCAACGACAACGAGTACAAGGCCCGCACCATCCGCGGCTTCTGCCACCTGTACGACGGCcaggaggccgtggccacgggcgtcgAGGCCGCCCTGGA
GCGCACCGACTCGTGGATCACCTCGTACCGTAACCACTGCATCATGCTCGCCCGTGGTGCCGAGGTCAAGGACGTCCTCTCCGAGCTCTTCGGCATGAAG
ACCGGCGCCACCGGCGGCAAGGGCGGCTCCATGCACTTCTacaacaagaagaacaacTTCTACGGCGGTCAGGGTATCGTCGGCGCTCAGGTGCCCGTGG
GCACGGGACTGGCCTTCGCCAGCAAGTACAACCACAAGGGCGAGGGCCTGATGCCGTGCGCCATCACCATGTTCGGCGACGGCGCCTCCAACCAGGGCCA
GGTCTTCGAGGCCGCCAACATGGCTGCCCTGTGGAAGCTGCCCGTGATTTTCTGCATTGAGAACAACCACTACGGCATGGGCACGTCCGCCCAGCGTTCG
TCCAACAACACGGACTACTACACCATGGGCAACAAGATCCCCGGTATCAAGTGCGACGGTAACGACGTGCTCGCTGTGCGCGAGTGCACCAAGTTCCTGA
AGAACTGGTGCGGATCGGGCAAGGGCCCGATCTTCGTGGAGATGAACACGTACCGTTACCACGGCCACTCCATGTCGGACCCCGGCGTGACGTACCGTAA
CCGTGACGAGATCTCGCAGATGCGTGCCTCGCGCGACCCCATTgagctggtgaagaagcgcatgATCGAGTCTGAGCTCGCCACGGCTGACGAGATcaag
gacctggagaagaaggtgcgcGCGGAGGTTGTCAAGGCCaccaaggaggccaaggcggcgagCAAGCCTGACGTGACTACGGCCTTCCTGGACGTGTACT
CGGACGGCAAGGGCAACAACGTGTACCCGCCGTTCATCCGCTTCCCCGACTACGCCAAGAGCCTGTACAACggcaagctccagcagtaA