Transcript Name :
Phypl_g1457
Orientation:
(+)
Number of Exons:
6
Description :
hypothetical protein PHYSODRAFT_554380
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
HmmSmart predictionP-Valprediction_id
Elongation factor P, C-terminal1.8SM00841
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-400
NN-scoreoddsWeighted Score
0.7323.2680.007
*** None ***
TypeScore
mitochondrial565
GO
Biological ProcessGO IDPrediction Method
cytoplasmGO:0005737IEA
*** None ***
*** None ***
Sequence
        2090 bases(100 bases per row)
ATGTTGCGGCGCGCTATCACGCAGATCGggcgcgcgacgacgcctgCCCGCGGCTACGGCGTGCGCTTTGCCTCGATAAATGGTCCGATCGTGTCCAGCA
CTCGATGCGCTATCTTTTCACACCGGCACCGTCGTCTAACGCCTAGAATTGACGGTGGTACGCAGGAAACCAGGTGCGCGCCGGCATGGCGCTCGAGATC
GACGGCAAGATCTACCGCGTGGGCAAGAACCAGCACGTGAAGCCGGGCAAGGGCGGAGCCTACGTCCAGGTGCGTCCTACCGCAGCTTTTTGCGTGGAAA
TCCACGCAGAATAGCGCGAGAAATGGGCTCACCGGAAGTGTGTCAATCGTGCaggcggagctcaaggagatcaagacgGGGTCCAAGATGAACCGCCGCT
TCCGCGCCGCGGAGACCGTGAACAAGGCGCCGCTGGGCCCGGACGAGCCGCACCAGTTCCTGTACTACAACGGGGACCACCTCGTCATCATGCACAACGG
GACCTTCGAACAGGTACGGGCGCGGGCTGTCtggtgttgaagctgctgggtcgaGATACTAATGTAttgtattgctgctgctggtatttagatggagatc
gagcgcgGGCTGTTCTCGGGCCGGCAGTTGGATTTCTTGCAGGAGGGCAtgacgctgtcgctgcagatcatcgagggcgacgtgctgtggGCCAACATGC
CCGAGCACGTGACGCTCGAAGTGACGGTGCGTGCAGTTCATGGTGCCCATTTCTCTAGTCGTTGCTGAGCTCCCGTGTGCTGAACCCATGTCGTTTTCTC
ACTCCAGAAAACCACCCCGAAGGGCGTGGCGGACACGGCGCTGAGCGTGAAGGACGCGACGTTGGAGAACGGCGCTGTGGTCAAGGTGCCGCTCTTCATC
GAGATCGGCAACAAGGTCAAGGTGTCCacggaggacggcgcgtACGTCGACAAGCTGTAAGCGTTGTCTCCACTCgcaggaagcagcagtgATGCGTACG
AGCAGAAGAGACGTTGCTGCAattaccccccccccccccattgAAAAATGATGCGTCTTCGTGGACAACGTTTGGTCGGATTGACGACACCGAGCTGTCA
CTCCCATTTGACAGTTTCCTCGCCGCCGACTTAATTTTAGCATACTGACACGGCACCGTGGGCAAGGACAAATGCGCGCACACAATTGTAGTTGGTGTGG
GTATCGTCACGTCCTCGCCGCCAATCGTTGAAGATCATGGAAGTAGCGGAGACGCCTTCACTCAGCGGTTTCACTGAAAAATCATGACCAGGTCGCGGCA
TCACATGCTCCGGTCAGGACGGCATGAGTTCAGGTTTGCAGCCGGCGCTTCGACGTCGGAGTCGCCCGTGGCGGAAGAGGAAGTACGAGGACTCAGGTGA
CCTCGAGAGCCTAGAGTCGAGGCCGGTTTTGGTGATcccgtggccgtggtcgcAGTGAGAAAAGCGCCTTGGGCATTTGCAATCGCTTTTTGATCGGTCT
GACTGGCTGTGCACAGTCTCATCCGTGCGACCTTTTACAGTACGGGGCCCGCCAGCGCGACTTCGTGCGTCATTCGCGCTTTGGTCCGGTCCTCCGCACT
CGACAGCccttcaacagcagcagtcaTGGCCAACTCCACCGAGAAGACCTCGCCACCCTCGGGCGACTGCCCGCACGCCGTGGCTTCCACCatcatccag
cgccaccgcgacaaccgccagcgcttcgacTCGGCCGACTACGAGATGGCGCAGCGCGCCTCCGGGCCGTGCACCGGCTGCACGTGCGGCAAGTGCGCGC
CGTCGGACGGCACCGACCTGGAGCGAGAGCCCGAACCTGGCGCCGCCGAGccgcgcgagcagcttcggtgtctccgtctccagcgcttcgacTCGGCCGA
CTGGGCCGACTGGGCcctgcaggtgcagcgcgcgcagcaggcgccgcagacgccgcagaCGGAGTCTCCCGCGACAGAGCCCGCGAACGCCGCACAGATG
CTCATGGACCGAcacgcgctcaagacgtGCGCGCTCGTGGGCCCCGCGCCCGTCGGCAAGAGCGGCGACCACAGCTCTCGAAAGGCATAG