Transcript Name :
Phyra_g9851
Orientation:
(-)
Number of Exons:
5
Description :
hypothetical protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Phosphatidylinositol-4-phosphate 5-kinase, core52.86PS51455
HmmSmart predictionP-Valprediction_id
Phosphatidylinositol-4-phosphate 5-kinase, core, subgroup9.99967e-42SM00330
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
Phosphatidylinositol-4-phosphate 5-kinase, core, subgroupIPR016034
*** None ***
InsideOutsideTMhelix
1-3
4-26
27-32
33-52
53-66
67-89
90-105
106-128
129-156
157-179
180-204
205-227
228-1204
*** None ***
PositionContextScore
506VSNRSGR|SN0.549
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        7402 bases(100 bases per row)
TGCTGCTCCCCCTCATGACCTCGGTGGCTTCACTGATCGGGTGCTTCTACGTCGTGGGGACCTATTGGCGAGTACTGGCACTGCGGCAACACCCCGCGGG
GATCATGTTCGGCATGAGTCTGTACGGGGCGATCTACCAGTTCCTGTACCTGCTGGACCAAGCCTCTAGCTCGGTGCAGTGCAGCGACATCGGCATCATT
GTGGACTTCTTCCTCACGGGCCAGGAGACGTACATGCTTATCTTCGCCATCGACCTTCTTCTCGCCCTGAAAAACCCGTTCTCGGCTTCCAAGGGGCAGA
TGACAAAATACCACATCTTCGGGGGCCTGTGGAGCCTCGTGTGCGCTGTGATATCGCACTTTGACACTCGGTACGCGCTTTTCGGGTTTTGCTGGCTGAG
CTCCAGCGGTGACTTTCTCAACCACCCGCGCAGCATAACCGATAGGGATGAAGCTTCCAACGGGACGCTGACAGCAGGGGTTTTCTTCGCCTTGTACATT
GTGGTGGTGTACTGCACGTCGCTGATCGCCATTGTGCGCACGTGGAACACGTTTGTAAAGGGCCTCCCTGACACGTTTCGTACTCGAAAGCGCATCCAGC
GCCACCTCAAGTACTACGTGGGCTGCTACTTCGGATATTGGACGCTGGTGCTCGCATGCTACGCGGTGTTCAGCCTGCTGCCGCACTCGGGAGGCGATAC
CAACGGTGGTATTCGCTGTCGTGTGTGGCATCTTCTATCTTGTCTACTACTTGCAAAAGGAATGGTACATGCTTTGATTTGGACGCGGACGTCCAACATC
CTCCGGATTATTGAGCAGCTTCGCAAGACGGAACGGTGAACCTGCCTTCACAAGACGGAAATTGGGACGACAACATCAATTGGGCGCTCCGACTGGAAAT
TCTCACAAATACCACGAAAGGAATTTGCCAAAGTGTGGACCGGGCCGAACGGCAAGCACGAGCGTCTGCCGAGGCGTCCTCGAGGTCAATCTCCGTATCA
GGATCTTCACTTGAGGAGGGAATCATTGAAGGTTCTGTAGCCCAGGATGACTATTGTGACCGAAAGGAGAGCTACACGCAGATAGAAGAGCTAATTCTCG
AAAACCGCAACGACCACCGAGCACGTGGTCCACGAACCGAAGGCGTAGTGTTCAAGGACTTTGCGCCGCACGTGTTTCGACGTCTTCGGGAGGAAGCCAA
GGTCTCGAGCGCAAGCTATCGAAATTCGCTACAGCAAACCACGAAGGAGCGAGTGAGTGAAGGCAAAAGTGGAGCTTTTTTCTACTTCACGGAGGACCGA
AAGTACGTGGTGAAGACTCTTACGAGCGAAGAGCTGAAGTTCCTGTTGAGCATCCTGCCACAGTACTACACCTTCATGAAGAAGAACCCGGACACGTTCA
TGACGCGGTTTTTCGGGTGCCATGGACTCACCATGTATGGCAAGACTGTCTTCTTTGTGGTCATGCAAAGCGTCTTCGCCACGTCACTCCAAATTCACGA
ACGTTTTGACCTCAAAGGGTCGTGGGTTGGCCGGCTTGAGGGGCGTAAGCCCACGGGTACTATCGCAACATGCAAGTTTTGCAACGCGGAATATGTAGTC
GGCGGTAGCCATGATCAGCTCTGCAATGTCCGCGGTGAAGGTAACATGAAGCATCAGTACGATCAAGTGGGCAAAGATCTCAACTGGAATCGTCACATGG
CGCTGCCGTATCCAACGGCACATGCTGTGGCCGAACAGCTAACGACCGATTCAGAGTTCCTGTGCAGCATCAATTGCATCGACTACAGTCTGCTGGTGGG
GATTCACCACCGCAGCTTCAACGTTTCGCACTATTCCTCTGCCGACAGCTTCGACTCGGCGGCGTTTGTTCACCACGATAGCTGCTGCAGTCTCAGCAGC
GGAGGCAGTCAGTTTCGAGTCTCCAACCGAAGTGGTCGGAGCAACAGCAGTGAATCCTACCGCTTCAGCACAAACTCGATCTTTGTCCGCAACCGTAGCA
GCAGCGGTGGCAACCAGAACAATCGTGGATGTTATTGCTCTTCCGGTACCAACGCGTCGAAGAAATCGCTTCACCAGTTTGCGCATAGGGGAATGAGTGT
GGACGAGGTCCACGGACCAGGCTTGTACTATCTCGGACTCATCGATATCCTCCAGCAATGGAACTTCCGCAAGCGCGTCGAGCACTTTGTCCGTGTTTAT
CTGTTGATGCAAGACCGGCACGGTGTCTCGGTGGTAAACCCACGCCAGTACGCGGATCGATTCCAGCAGCGCGTCATCACGGAACTCATCTACGACGCGG
CTGCCATGCCCACACGAGATCACCAGGACAGTGTGTCGTTCACACAGCTACAAATTCAGAACCAGCGCAATGCCCAGTTGGTCGAGTCCAACAGAACCCT
GAGCACCATGTTGGCTTCAATGGACGGGAGTGCCGCCAGTCAACCGTCGATGCGAGTAGAACCCCTCTCCAATGCCACCCTGTCACCGAACGTAGGTGTC
AACTCCATATCAAATACCCCGTGCACCCCAACGATAGCTGCTACGGCACCAGTAAAGTCAGGAGTAGCAGTTCGCGCCACCTCAGCACGGCATCGAGCAT
CCTCCTCATGGGATAATGGTAGTAGCAGCAGCTCATGTGGTGTTGGACGTCTGTCGGGTGGTCTGATCATGGAGATTCCAGGATCAAATCTGCCGATGGT
GTATCCGACAGCGTTAGATGCATTGCCACCGCACCTTCGTCGATCACTCGCACCGCTGACTCCATCTCCGAGAACATCTTCAGCGTATCGACATGATTCC
GAGTTTTCAAAAGCGAGCAACCAGCGGTCGAACAGTTCCGGCACAGTGTCCAGTATCAGTAGTATCGGGCGCACTAGCAACAACACAAACACTGTGGCGC
ATCTGAAGAAGGCGCGCTAAGAGGCCCAGCCAGCCCCCTCGACTACCGGATTGTGTCCACTCCAACGTTCCCAGATAAAGGTGCCAATGCTGCTACACTA
TCCGCCTAAACCATTATCAATACCAACGTATTTTGTTTGTAGTCTCGATGTGCTTAAACTCCCAGTGTTTGCTTGATCAGGGTCGAAAACCAAATACACA
GGAACAGTATCTGAGGATCGACACTATTCTTGCTGGCCGTTGCTAACGGACTTGATTGCCTGGACGTAGTGAGGAATCGACGGTGTTGAAGGCAATGGCG
ACGGTGCTGCAACGAGTCAAGGACAAGCGTTTGACGGCGGCCCAAGAAGATGAAAGTCGCGTGGTCTTCGAGTTGGCAGCTGAAGGCTCGGAAACGATGA
CGGTCAAACAACTCAAGATGAGTTTGCGAGCGCTGGGCTTCAAAGTCGAAAGGGGAGGCACAAGCGCTTGTGTACGAGTTCGACTACATGGACTCCGGCA
CCATTGACCTCGCAGACTTCCAGAAGATTTTCCTCTCGAAGGTTTGGATCCCAGGGTCTGCTTTGCCTGCCACGACGTGCGTGGTAGTATTCGTAACTTT
ATGCTGGTGCGAATGATCGTTGGTATGTAGATGCTGGACACGAGCGAGCAGGAGAAGTTCGAACAGGCATTCAGGTAACCACCACTACTGCTGCAACATG
ATTGTTGCACGCAGCTAAACGTGCTGTGCAGGGCTTTGTCGAACAACGGTGCGGACCAGGTTTCAATACGGGAACTATCTTCGGTTGTGAGCACTCTAGC
TACGGAAGACGAAGGAAAGAACGCTGCAGACAAGGAAGCAGTCGATGGGAACCTACTTCGACACCAAATGGGTCTGCAGTACCACGACGACAACGAAATC
GAGGCGGTGCAAGCATTTTTGGGCACCGCAAGCAACGCTGCGGGCGGATTTTTCCTCTCCAAAGCTGCACTCGCAGCATTCCTTCGTGTATAGCAATAGA
CTCTGGTACACGATTTCTCGCTGCTGCTGTTCATCCTAGTGAGGTGGAGATGTAGACGTGGTTTCGATCCTGCAGCACGTCGCAGATCACATCGGTGAGT
TTGAGCTCTCGCTTGCCGTCCTTGATGATCTTTGTGGGGACGCCCAGCTCCAGCCAACCTTGCGTCTGGCCGTCCTCGTCGAACGAGCAATGGCCACATG
GCCCAGCCACACAACCTGCTGGGTACCGAACCCGCAGTGGACTGGGATGATCTTGTCCCGCACATGTGCCATGATGGAGATCGTGTCGTCTGCGCCTTCG
TTCGGCGTCACTTCGGCGTCGTCATCTTCATCCAGACGTGGTTTCTCCTCTTGTGTATTCTCTCGCTCTTGTTGCGAACCCTCCTCATCCACTACAGGCA
ACGTGGTCGGCGTCCTCATGCGGGGACCAAGTTGAAGTCGTTGCTGTAGCCGTGTATGTTAGCCACACCATATAATGAATCTCTACATAATGTACCCAAA
TCGTGGTACCCTCATCATGCTATTCTTGTGCACGTTCATATTGGGCAATGCCGCGCTCCTCCGCGTCTTTCCTGCGGCGCTGGCGGCTACTGGTGGGCGC
CGAGGCGGCTCTCACATGCGTCGCAGATTGTCTCACACCTCGCGAGACTGTCTGCCTGCTGGTCTTCGCGCTAGATGCTCAGTACGAGCCGCTGGCGCGC
TTCCTGTACGCGCACGCGCACTTGCTGTCTCTGAGGGACGCACGTCACCGCTTCACGAGTGTTCTGCACTGCGCGGCGGCTCATGGCTGCGCGGAGGTGG
TGCAGTGGCTGCTGCGCTTCCGATTAAGCCATTCTACGCTGCTCACAGGCGAGAAACAAGCGAAACACGACGTGTGGGAGCCCCAAAATCCTCCAAACAA
GGCAAAACGCTCGCCTGGATCTCACGCAACGCCCCGTACGAGTTCCCGGCCGAGGTCATGCACGAGGCAGCCAGACAGGGAGATCAGGAGGTCGTGCAGT
GGCTGCACTGCTGCTGCCAGTACGAGAAACACAGGGCCATGGAGTACGCGGCCTCGGCTGGACGTCTGGAAGTCGTCATGTGGCTCCATGAACAGGAGCA
GAAAAAGGAGCAGAAGACTACGGACGTCGATGTGTTCATGGTGCAGCCACTGGAGTCCAAGCTGCAGGTGGTGAACTGGGTCGCGGTGTTCCCAGCACGC
AAGTGCTTCCGAGAAGTCTTCGCGTCGCGAGCAGGCCTGCTGGCTGGTGTCTACGACCAGAGAGACCCTTTGCTGCCGTGGGAAGATGCGGAAGCTCTGG
CCACGTCACTGGGGAGAAGACGCTACCGTGCGCTGGATACGGCAGCGGCACAAGGAGATTTAGCTATGGTGAAAACGCTGCATGAAGATGGACGGTGGCC
GTGCACCAGTATGGCCATGGACACGGCGGCGGCGAACGGACACTTGGAAGTGATCAAGTTTCTCCATGAGAATCGGCGCGAAGGAGGCACTGCCATTGGA
ATGTGTAGCGCGGCAGGAAATGGACATTTGGAGGTGGTGCAGTGGCTACACAAGCATCGCAGCAGTGACGGATGCCGCTCGCTGGTGCTAGACTTAGCGG
CGACTAATGGGCATGCGGACGTGCTCCGCTGGTTGGTGCCTCGTTTCCCGCGGTTTTCGTGCTCCCCTGCATTTTTACCGAGCGTTGCAGCTCACGGCAA
CATCAAGACGCTGCAGTATTTGCATAAAGACATGAGGATGCCGCTGGATCCGCGCACACTGGAGGCCGCTATTGGATCAGGGCATTTGGAGCTTGTGAAG
TACATTACCGAGCGTATTCCCATCGAGAAAAGATACTCGCTGTCTCCCACCGCGGCCGAGAAGGCAGCAGCAAGCGGCAATCTAGCATTACTGGTTTTGT
AGTGGAGCAACTTGGGCTCTGGTCGCCACAGATGCTCATTGCTGCGGCCTCGACGGAAACGTCAAGATGGCGAAGTGGGTTGCAGAACGTTCAGATAGCC
CCTCCAGCGAAGCGAAAGAATTGAAACTGCCCCGGGAGCGTCGAGATCGTGCTGCTACCTCCAACGCAATTGACGCTATGCTGCCGGGCCTGTCTTCCGT
GGAAATCAAACGACGATCGTCATATGATAATCTCACGTCAGTGGAATCTTCTCGGCCGGTAAACATCGTGGATGGCAGCACACTGTACCGTTGCGCCTCA
CTCGGTCATTTCAGCATGATCGAGTGGTTATTGCAGCGCGGGCTGGCTTCACCGACGTTCTCGCTGTCCATGAAAGAGCGCGAAATTGTTCTACGCTCGG
TCGTAGGTCGTGGAATCACCGACGAGGATGCAATCGACGTCACCGCTCTTTCAGGAAGAAGCAGTGGTGAGCTAAACGGCGGTGTTAATGCGGCGGCAGA
ACCACCAACGACGGCTGTTACTGCAGCAGTTATTACGACCGCGAATGCCAATGACGGACCGATCATAGGTGTCCCCCGTATCGCTGGAGTCCGATCAAAC
ACTGATGAGAAGCGGGCTGGTTTTGAATCTTTTGCGTGGGCGCTCCCATGCAAGACAAGCCCTTACTGGCAGACTAAGTTCGTCCGCCTCGCGGTACAAT
ACTGTCCCGAGTCATCATCAAATCTCGAGTGGATGCCGCTGTGGGCGGCTCAACGGGGCGAACTTGATGTGCTGAAACAACTTTACAGTGTGAAGCACCC
CCAGTTGTTCACGCATCAGACATTCACAGCGATCATGCGCTATACCAAGGCTGGAGACGTCCTTCAATGGTTCCAAACACACAGTGCGACGCTCATGGGG
GATTCATCCATCGTGGAGTGGGGCGTGAAGTACCGGCAGTTTTCCTACCTAACGTACGTGTTCCTGAAATTTCAACCTGTGCGAACCGAGGAGCGTTTCC
GGCGGCATGGCGTCGAGTACGCGCTTCATGTGGCGTGCGCTATGGGGCACCTGGACGTCGTCACGTGGATCTGTGGTAACTGCGAGATCTTTTTGAAAGT
GCCAGCGTCGGAGCTACACGCAAAGCTGGGCAGGTTGACAATCTGGAACGACGCGCTGATTGCTGCTGCGCGCTGTGGGCAGATCGGAATTCTAGTTTGG
CTGCACGAGAAGTTTACCTTCTTCCGTAAGGTGCCCGACAGTCCTCGCAAGATGACGCTAGTTGGTGCTATGGCCGACGCGGCCGCTGGATACGGCCAGC
TCCGTGTGCTGCGTTGGCTTCAAGCTACCGTTGCTCCTCAAATGGTGTACCAGCAGGCGGAACCGAAGACGGCAGCATCACAAGCACCAGCAATGGTAGA
AACAAGCTTCGTGTCTACTGAGGGACTACTCGAGGCCATGGTGAACCGCCAGGTTGATGTGGTGCAGTGGGTCTGCGCCGTGGACATCGACCTCGTGGCT
CGGCAAACAGCAACACGACGCGGAGAGCTCGTGACCTTCCTTCGCGAGGAGGCTGACGGATTCGTGTCGTCTAAGTTGGCATTCGTCTTCCCACCACTGT
AG