Transcript Name :
Phyra_g5255
Orientation:
(-)
Number of Exons:
4
Description :
XP_008900802.1 hypothetical protein PPTG_08459 [Phytophthora parasitica INRA-310
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
HmmSmart predictionP-Valprediction_id
Aminopeptidase P N-terminal domain2.5e-29SM01011
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-829
NN-scoreoddsWeighted Score
0.5471.70.003
*** None ***
TypeScore
nuclear30.4
GO
Biological ProcessGO IDPrediction Method
aminopeptidase activityGO:0004177IEA
*** None ***
*** None ***
Sequence
        6079 bases(100 bases per row)
TGAGCTCTGAGAACGTGAGCGGCCTCTTAGCGGCGGCCACGGCCACGGTGGCCATGGCGTCAATCGCGCTGCTGCAGAAGACGCGCGCGCCGGCTTACGA
CCCCAAGAACCGCAAGAGTGGCGGACCGCGCCGGCCGAGCGCGTCCCTCAACGGCCACTCGCACGTGACCATGGTACAAGCCGGCCGCGCGCTGGCCGAC
CCGGCCGAGGGCTACGAGCTCTTCCCCATCGACTTCTCCATGCACGCGCAGATCCGCCAGAACGTCGTGCACCAGTTCCTGCAGACGCACCCGCAGACCA
AGAGCAGCGCGGCCGCCATCCTGGTGCACGGCGGCGTCGAGGTGGACCGCTACGACACGGACATCCAGTACAACTTCCACCAGGAGAGCTTCTTCCAGTA
CCTCTTCGGCGTGCGCGAACCCGGGTGCGCCGGCCTCGTGGACCTGTCCACCGGCAGCGCCGTGCTGTTCGTGCCGCGGCTCAACGACGAGTGGGAGCTC
TGGTGCGGAGACCGCAAGCCGCTGGCCTACTTCAAGGCGCACTACAAGGTGGACGACGTGTTCTACGTGGACGAGATGGCGGCCGTGCTGGCCGACAAGC
TCAAGGCCAAGAAGCTGTTCGTGCTGCACGGGCAGAACACGGACAGCCAAGCCTTGGACGAACATGCGGGTAGGGGAACAAAAAAAAAGGTGAAAAACGC
TTCCACGAAAAAGAGGGAACATGAAAAACGTGATTTTCGTGTTCTCCTCGCTAAAGTGCGAGAACAACGAACATTTTTGCGAGCTTCCCTCCCGATATTC
GTTCTCGCGCATTTCGTATTTATGCGGATCTGGCGTGTTCGTATCCTACGCGTTGGATTGGCTGAAAATCGCACGATCTTCCACAGCCGCACTGAAATTT
ATCGAGCTCACTCGCGAAGATATCCTCTGCCCAAGAAGCGGCCTGCGTTCGCATGTGCTGAGCCTCCGACGCGCTCGAAGTGCAGCCGACAGACTCGTGA
TCACACCAGGGACCCTGAGCACTGCAAGTCTATGCTCGTGACCACCACACGGACCACGGCACCTTCCAGCACACGGATCAAGTCAAGGACTTCAGGAGAA
GGTCAGAGGACTCCGCCTGAAGCAGCAGTACATGGACTAAATCCACCTGTGACCCACACTCGTGGCCACCGCAGGGACTCACTGTGCCTCCAGCCTCAGC
TTTAGTCCTCGGACTTCAGGTCAGAGGCTCCGCCGCCAAGCATCGAGCTCACAGCGCAGCCGACAAGACTAGAGACCGCATCGGGGACTTACTTCACACT
CGTGACATCTGCAGGGACCCACGACACCTCCAGCCAACGCGTGACGATGACAGAGCCACCTTCTGTGGTCCTCCAAGCAGTGAAAGAGTTCCAGGCCCTT
GGACCCTTCGAGTTGGTGCCTCCACGACCAAAGGAGACTTCGTACATATTCAAGTGGGGGGTTCGTGTCAAGTACATCGAGAACGAGAAGGAGGTCTTCG
CGTGGGCTTGTTTGGCCGACGAGGCGTGTCGGACGTCAGGAAAAAACCTGTTCAAGCTCTATGCTGGCAAAACGACCATGGCCGTGAAGCACCTCCAGAA
GATACACAACGTTGGCTCGCCGAAAACAAAGATAGCGACCGTCAAGAAGCGCAAACACGACCATGATTACAACCACCTGTCATCGTCCGCCCTGTACTCA
AACAACCCAACCCGGCTAAACGTGCTGATGACCACTCTCATGATCATCAACCATAACTTGACGTTTCGTATGGTGGAGTACGAAGAGGCAAGACTAATCC
AAGCGCTACTCTATAAGGACGAGATGAAGGCCAAGATAACTACAAAGCAGGTGAAGGAATCTATCGTGGAGCTGTATTCTTCAACACGCAAGGAGATCAC
TAACTACCTCCAAGAGAACCGAGAGGACTACCCGAACTTTACGCTCGTGGCAGATTTTTGGACTTGCAAAACAACGCAAGACAAATTTCTTGGGTTGCGG
GTTTACCTGGTGGACAAGGCCTGGGAGTACAAGTCCATTCTCTTGGGAACGAGAAAGTTCAACCCCGCATATGGAGATCGTGATGGCGGCATTGTCAAGC
CCTTCAAAGGGTGGTTGAAGCACATGCTCGAGGACTTTGGCTTAGCGACGAGCGATTTCTACGGGGCTACGAGCGACTCGGGGGTGACGTGAAATCGATG
CTGTGCAAAGAACTCAATCTGCACTGGGAGTGGTGCTTCGCACACATGGCCCACGCAGCTACAAAGTCATCATGTGGTGTAAATGGAGCTGCTAGTGCTG
CAGCTAACCCGGAGATGGCGGACTTAATCTCACGGATGGTAAGAACAATATTTCAGGTCAAGGTCGTGTCTGTCACTGGGAGCTTATTTGCAGAGCTCTG
TAAGTCTAAGACTCAGGGTGCCTCCACGCGACTTGTTGGATATTCTACTTCACGTTTCCTGAGCATGACGCGTTCATTGGAGAGAGTTCTTGAGAAGTGG
CCAGCAATAACTGCGTGGTATGAAGAGCGAGCTCGTAAAGCACTTCGTGCCAACCAGCCACCACCAGAGTTCCCGTTGGCTAATCGCCATGACGACTTGG
TTCATGTGTTGTCTGTGCTGAAGCAAATCGGTGAGATCAAGCGAACATGTCAAGCAGAGCATCCTGTTCAAGTCGACGTGCTCGTACAGTTGTATATGAT
GCGTATTCACGACCTCGACCCTGATCAGCCTTTGCCACACTACCTATCAACCGACAAAAATCCTCGTTGGATTCCTGCAAGTGACCTTACACCACTGGCT
GCGGATGTACGGAGACTATTGCGGAGAGCATTGGACGAACGCTTCTTCAGCAGATATTACAACGACAAGCAATTCCACAAGTGTCAATTTGTATTTGAAA
TGCAGTTGAAACTCCACCCTATCTTCAAACGAACGGAGAGGAGCCTCGATCGTGCAGTGATTTTGTCGTGCCGTCAGCATGGCAAAAGCGAAAGGGATGC
TGTGACCAGGAAGAATGATGTGAACGCCAAAATCCGCTGCAACTTATTGGACTTACTTAAGGCAGTAAGTGAACCCGCGGACGTCTCTGAATTTGAACCA
CCTGCACCTGTTGTGCAAGTCAGTCGACTGGAAGCAGAATTTGCGCCGAGATCAAGCCGACCACCAACCTTTAGCCGGCAGGATCGACGCGCAGAAGAGA
AACTTGATCGATGGCTGGAAGATCCTGTCGACATTGCACGAAAAGAGGACTACACACCAAATGAATCAGTACTTGAGTTTTGGCAAAGACTTGAGCACCA
AGGCGACACCGTATCATACCGAAAGCTGTGAGAGTGCTGTTCTCAATACCAGTATCTTCGTGCCAGATTGAGCGTGATTTTGGTGTAAGCGGGCAGATGG
TAACTACACAGCGCACGACATTAGCCGAGCACAACATCGATATGTGCTCATTCCTGAACAGAAACAGCGACTTCGTTGATTTATTGCAGTGTGAGGAGAT
CCCAAAGGGACAGCATCACTTGCACACACCTACAAGCTTCATCTTCCCCGTCGCTGAAGAAATGGACTATGACTGGACGAGATGACAAGCGACCTTCTGG
CCGACTTCGCTTCTAGTATGTCACTACCTGACGACTTCGAGGAAACGAAATCGGAATTGTGAATGTAGTAAGAAATTGACAAGATGACTAGTGAGTGAAT
TCACACACGTATTACGTTATGCTTTCCGTTAAGCATCTCTCGTAGCCACGCTTACCTTGCCCGGCCAGCTGCACTTAGACAACGCTGCCACATTCACGTT
CCACTGCTCGACAAGTAGTGTTGGGCTGTCTGCTCCGCTCTCATTTGCACTTGAAGCTGAAGGCCTAACACGAGTACACTTTGCGCCACCTGTTTGTGTG
CTCGCGCTCGATGATGTGTGCGGCGTGCAGGAGCTCGAGCGCGTCCTCGAAGTGACTGCAACCGCACAAGGCCGGTAGATGTCGGACGAAGTGGTGGCGA
ATATCCTTGGTACTCCTAGGTTTTGACGAAGCACGAGTCCCACCACTGCCGCGGTTGGCCTCACAACCGCCACCCTGTTCGATATGCACCGCTCGGGTGA
TGTCGTCAGTGGCGAACTAGCTCCTTGTAGTGTCTGTGGCGATTGATCCTCTGTCTGTGTCGCAGCAATTGACGCCAACGTAATGTGAACTATCGCCACC
ATGTGTGGCTGATCCCTCTCCAACGCTGCATGCACCTTTGACTCATCATCAAGATTGCTTGGACGGCGACTCTCTCTATTAGGCAGTTGAACAGGAGAGA
CAGGTCGTGGTGCGTGTCGGTAGGATTTCTCCCATGCCTCTAGCATCCTCATCTCGAATTCACTATCTCCATCAGAGTCGCTGCCACTGTCGCCGTCGTT
GCTCCAGTCGGGCTCGTAGCGTGTCGTTCGGATTCTCTGGCGCTCGTCTACAGGCGTCAGCTCACGCACACCCTCCTTAATCGTCTTGCAGATGGCATCA
ACAGCTGACTGCAAGCTGTGTTCAATGCTGTATTGGGAAGCTTCGGGCTGCTCGGCTGGTCCACCTTCGTGTCGCACCGCGTCGTCACCAGACTGGGATT
CCTTGCTCTGCAGAGTGTTGATACACCGATCCACGTCCTTCTTCGCGTCATCACCAGCGGCGCCGATCTCTCCGTCAGCAGCGGCGTCGTGAATCTCCCC
GTCGTCGATGTCGCCGTCGATCTCCACATCGTCCTGAGCAGCAGCTTGAGATCGAGCAGCAGCTTGAGCGCGAGCTTGAGCGCGAGTTAGCACCATCGTC
GGGAAGACTGCAATATTCTCCCGCCTCTCCAAGATCTTAATAAATTACCGTTTGACTAATAGCCAATCGCAGAAAAAATCATTTCTGCCAACCAGACCGG
CGAGAAGCGAACACATCCCACTGTGCAGTGCACACGCCAGCCAGCATATTCCCCTGCAAAAACCGATATTACGGACGAAGGTCCAAAACCTCGAGAACAA
TATTCTTGAGGTTTTTTACCTCCCCACTTCGTTCCACGAACAGTGTTCTTCCAATATTCGTCCAAGGCTTGCGGACAGCGGCCTGGAGACCACCACCACG
TCCACATTCGAGGGCATCGACCAGTTTGAGGTGGACAGGGAGACGCTGCACCCCGTGCTGGTCGAGTGCCGCGTGATCAAGACGGAGAAGGAGCTGGAGC
TGCTGCGCTTCGTCAACAAGCTGTCGTCGCGCGCGCACGTCAACGTGATGAAGAACATCCGGCCGGGCAAGATGGAGTTCCACGCCGAGAGCGACTTCCT
GCACTATGTGTACAGCAACGGAGGCGCGCGCTTCCACGCGTACACGTGCATCTGTGGCAGCGGCCACAATGCGTCGGCGCTTCACTATGGCCACGCGGGA
GCACCCAACGACAAGCTGCTGGAGGATGGCGATCTCTTCCTGAATGACATGGGCGGGGAGCTGCACGGCTACACGTCGGACATCACGTGTTCGTGGCCTG
TGAACGGCGTCTTCTCGGCGGACCAGCGCATGGTCTACGAAGGTGTATTGAAGGCGCACGACGCGGTGATGGCGGCCATCAAGCCTGGGATCAGCTACGT
GGACATGCACTTGCTGTCGCACCGCGTGCTGACGCAGCACCCTGCTCGAGTACGGGCTGTTCCAGAACGGCACCGTGGACGAGCTCATGGACCACGAGAT
CTCAGCCTTCTTCTACCCGCACGGCCTGGGCCACTTGATGGGCCTGGACACGCACGACGTCGGCGGCATCCCCGTGGGCTACACGCGCTCGACGAAGAAG
ATCCTGGCCAAGCTCCGGTGTGTGCGCAACTTGGAGAAGAACATGGTGCTGGTGCTGACGGTGGAGCCCGGGTGCTACTTTATCGAGGCGCAGATCCAGA
CGGTGCTGGCGAACCCCGTGACGGCCAAGTTCATTAACCAGGAGATGCTCTCTCGCTTCCGAGGCACCGGCGGCGTCCGTATCGAGTCGGATGTGGTGGT
CACCGCTTCCGGCGTCGAGTGCATGAGCAAGGTGCCCCGAACTGTCGAGGAGATCGAGGACATCATGCAGAAGGCGTAG