Transcript Name :
Phyra_g2314
Orientation:
(-)
Number of Exons:
6
Description :
GBG66957.1 hypothetical protein CBR_g74645 [Chara braunii
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
HTH CenpB-type DNA-binding domain11.206PS51253
HmmSmart predictionP-Valprediction_id
HTH CenpB-type DNA-binding domain0.00000012SM00674
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
HTH CenpB-type DNA-binding domainIPR006600
*** None ***
InsideOutsideTMhelix
1-755
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        7170 bases(100 bases per row)
TGGAGATCCACGGACAATCCGAGTTCGACGTGTTCGCCAACCCCGTCGTGTCGTCCAACGGCGCCAGGGTCCTCTACGACGGGTACGCCACTTTTCTCGA
TGAAGGTTCTCAGTTCACGTACTCGCTGTGTGAATGGCGCCGCGTATTTGGCGACAAACGAAAGCTCGTCAACTGCCCAGACTTCCGAAACAGTTCGATG
TCTCCCCCCTCAGTACGCTACCATTCAGCTCTATTCTGCCTGCGCTGAACGATGTCGAGCCGATTCCAAGCGCGTCTATCGGCGACGTTGAGGTCGAGTG
CGAGAGTGGAAACTTGTTCAAACGACGTTTGCTGGCATCCACTACGCAATCTGCGCGGCGGGGCGAAGATGGATTTACTGCCTTCAGCAGTGACTTGACA
ATCGACGTCGAGTACCTGAAGAACCCAGTCAGCATTTTGGCCCCAAAGCTGAGCGATGGGTCGCGTGTGATGCAGTAGCTACCCCCACGCCGTCACTCCG
AGTGCTTTGGCGCTGATGACAGGAAGTGCCATTCCAAAAAGTACGTCAAGAAACCTGAGGGAGGCGGCACACTTGGCCTTGGAAGCTTCGTCGTGCGCGT
GCAACTCGACACCTCGCCGTGCATCTTCTTTCATGGTCTTGGCAACGAAAATGACGAGCCGGGGCTTGTGGACTCCATTCGCCACTTTGGCTGGGATAAA
ATTCAAGGTCACGCTCCTTGCTGCACAACGATCAAGTACGCTGCGCTGAACACGATCGATTACGGATGGACGAACTCCTCCTTGCAGCAGAAGGTGTGTG
ATCGCGCGCTAATGGCGACGAATTCTGCCGACTCGCCACGCGGTCAATAGAAACACCATTGTTGTGACGCACTCGATGGGTGGACTGATGTTGCTGCCGC
GCTTTGCCAACAAAGAGTGCACTCTTGATCCAAGCTCCACGTGGATAGCACTGAGCCCCCCATGACTGGCAGTATGTCTTCCGACTACCTCATGGATTTC
TGCAAAGGTGAAATCGACGGCTTTATGACGGATCTACTCTTCATTGGTAGATGCCCAGCTTCCGCGGCTACGAAGTCCGTCGTCTACAAGAACGAAAAGT
ACAGCACGGCGAGTCTTGATGCAGCCTACGATGCGGCCTCGGCAGTCTATCGCGAGAAAGTGTATGCTGCGATGTGCAGTAGCTCCTACATCGGAAACAT
CTCCAAGTATCAAGCAAAGTATATGCTTGGAGGCAGCACGATCCCGCACAAGTCCTCCAAGAACGACGGCCTTGTTGAATTCCATAGTTGTGCAGGTGGA
ATGTCACCAAGCAAGTTCGGACGAACCCCCCGGGACAAGTTTTACAAGTGTGAATTGAACCATGCAGACACGGCATTCAAAACGGGAGATGGTATTTTCA
AGTCCACCGTAAGGCCCGTGACATGGTTCGAGTGCCTGCTGTAAGTAGACAGTGCTGCCAAAGAAATACAATTTTCAATTTCGTAATTCTCATTAGCAGA
GTAGGTGCACAGTACACCCTTCACGTTATTTAGTCGACCCCTGACTAATTATGGTTTACGTGAAGAAATCTGAGCTTTTGGTTAGCTGTTGTGACCTCAA
TATTTGGGCACGACTAAGTAGCGCGAAGGGTATATTGAACTGCCAAAGTCATCTCACACATCTATTTCTCGCTCTGACAAGCTTTCGTTGCATGTCATCA
ATTTATTGGTTCGCGGGCACACTTGATTCGCAGTTCGGAGTTTTGTATTTTTTGTTTTCCGGTTTAATGCTCAGAAAGAATGTTGCTGGAAAGTCGACTG
AATTGAATGTTTCGTGAATGTTGTTTGATGACAATTCGCCACCGAAATATCGTTTTATTGGTTTGCGGGTTAAAACCAAATAGTTTTCTGGGTAAAATCA
AACACGTTTTGACCACTACCAAACACACAGAGTCTCAAGCAAAAAAAAAAACGCTGAGAACGAGTTGGTCCTGAAACAATAATCGGGCAGGATCAAAATT
GGCATCTCAGTCGAAGTGTGGTCCACTGTTCCTTAGGGTTTTAACCTAACCTACCGTCTTACCCCGCATAGAGTGTCTAGGCGTAATAATAAAAAATCGA
TGTGCTCAAAATCAATATAAAGCCCCGATCACAACACGTATCGGAATAGAAGGACGCCCACAGAGGAAAGGGTTCTTTTAAACGAGGTCTGAACCAAGGC
TTCTAGGTTGACTCTAACAAATGGCTAGACCACCTACTCTCCAACCATTCTTCTCTACCGGTGGCCATCGACGTTGCATGTACTCATAAGCTCATTAACA
AAAACACTCGTTACCAGCAACACCTTCACCAGAAGCTTTCCAGTGCACGATGCCCAGCTCACGACGCAGCTTCACAATAACAGAGAAGCTCTCAATTCTT
GATGAATATGAGCCCGGTGTTCAAGGGAAGGGTTTTCATGCTCTTGATCGTCAACACGGTGTTTTGTCTAGCACCATTCGAGGCTGGTAGGCGAAACGAA
TTGAGCTGGAGAAGGCTTCGCGCGATCGACGAATTACCACACGAACGGCCCGACGCCTCAACGGTGGTGGGCGACGACCAGCTCACAGTGACATGGAGGA
GTTGCTTTACGAGCGGGTCACCCACCGGAACAGCAAAGGCCTGCGTGTGAAAGACTCGTACATTCGGCTGCATGCGGTCAACATCTATCGCGAACTCCAC
GGCGGCAATGCAGCTGGCTTCGAGGCCTCGTCGGATTGGTTAGCGAGATTCAAGAGACGTCGGAACTTGGTGTCACGCAGACAGACAACAACCCGGACTC
TACCAGCTGATGCACCTGACGTTTGTCAGCGTTTCATCCAGCAAGCCCAACACCTCATCGCCAAGCATGGAATCAAGCCCAAAAACATCATCAATATGAA
CCAGGTCCCTCGCTACTTCGAGACTGAGCCCAAATCAACGATAACTACCCGCGGCGTTCGTGAGGTTCTGCTGCGAAAGGGCGGCTCAAGCCACAAGTGT
TTCACAGCGACGTTTACTACCACAGTGGAGGGCGAGTTTCTGACGCCACACCTGCTCTTCTCCAAGCTGAAAAACAAGCCCAAGTGTCCTGCTGGTGTTC
TTGTGGATGTCAACAAGACCGGCATGTGGAATGAAGACCTCCTCCTGGCTCATGCACAGACAGTGGTTTGCGGAAGGAAGGAGACGCAGCTCTACCGAGA
GCCCGTCCTCTATCTGATTGATTCCTATGGATGCCACGTGAAACTGGCGGACTCAAAGCGACTGGAACGCTATAACGTCTTCGTTCTCTTGGCCCCACCC
AATCTCACCAACCTGCTCCAGCCACTGGACGTCGCTGTCAACAGGAGCTACCAGGAATTCTATCGGTCAAAGTTCGATGAGTACATCAGCTTGGCCCTCC
AAGACAAGAGCCTCCAGACCAAAGCCGGCAACCCCAAGGTTCTCCGTTCCGACACTGTGGCCCAGTGGACCCTTGATTGGGTGAGCTCCAAATCGGCAGC
CGACGTCAAGAAGGTTTTCTCTCTTTGTGGCTTGGTAGCCAAAGAAAACTTTCAGGTGGATCAACTACACGCTCCGCTAAAAGATATCCTGAGCACCGAC
TTCGACGTGAGGAAGTGGCATGCTTCGTATAAGCACCTTGTCACGGAAGAAGCCGAGCGAGAGCTGGTGCGAGTCTCTGCTCCAGACTGGTACATCCCAG
AAAAGGAGAGAAGCACCCTCTTCTGTTGTCTATCGTACGATTCTGACGTGCTGCCTCACGAGTACGCATCTGCCTTAACCAATTACATGGCTACGCTGGA
CGACCTGCTTGGACTACTGGATGAAGAGTACCTCGTGTGGCGAAGCGGGATCACGAAAATTGCTGTCGTGATCTCCGGCTTACCAGCGGTACGCCCGGAC
TGCCGACTATCGGAGGGGGTACTCCGTTGATCTGGCGCGATCGGAACCTTGTATTCACCTTGTGTACCCGACGGCGGGGCGGGTTACGCTCTTCCGGTGT
TCACTGAAGGCGTCGGTGGTTACCAGGATGGGGTGGGGAGCTGGACGGCTCCTTCCGGGGAACTGGGGGTTTGACGGCCACGCGGGTATTCTTCACGTGG
TCGTCGGTCGTCTGCCGATCGGGGCCTGGTGGGGCTTGATCGGCGTGGGGGGTGTCCTTGGGTGTGTTCCTTTACGTGCTTGCCGCCTCCTATGGCGGGG
TCTTCTGGGGGGGGTTAAGTGGTTGCGCACCTGGCCAAGCGATCCAGGGGCTCCCGTGTAATTACCTTGCGCGACGAGGTGAGTCCGAAGTCGTCAGGAG
GGCCAATATACTTCCCAGCCTGGAATAAACGAACGCCACTTGTGTTGCAAGGGAAAGCTTCTTCTTCTCTTATTAGGTAAAACAAACAAGCAAAAGCAAC
AATGACCTCAGCTTCCTACCTCCCCCCTTTACTGGATTCTTTCACCCATCTCCCGAGGTACCTTCCACAGATCTTCTACTCCGGAATGATTGCGGACGTA
CCACCAAAGTGGTACGTCACGATCGCCATTTGCGATCGGGATCGCGATCGCAGTGGTGGCCACGATCGCATATCGAAATGATCGCACCATACCGCATACC
GGTATACACCGATGACTGATGGCGCCACTGTACCCATTGGGTCTCCATACCCCTACCCCTCAGGTCCAATTTAATCCCTCCAAAGTCTGCCTTCATCAAC
CTCCGATCGTACGTCCGGTCCCGTCCGATCCTAGCCCATCGTTGGTCCATCACGAAATTTCCAACATCCACTTCACCACAATCGCCCCCTGTACATGCCG
GGGCTGCCCAACAGTCTTGGCGTGCACACTCGTCACTTCTTCTTATCGCTCCTCGCCACCACACCTCCACAGCACCATGTCGGACAACTCTTCGCCGGAT
CAGGGGCGTTCCCCGAACGATCCTTCTTCCCACTCGCCTACGCCCGCCTCTTCCCGATCTCCTTCGTCGCCGCAGAGGGCTACGACCTCGAATTCGTCCA
CCGCTGTTCCTGTGGCTTCCGATGCCACCGTCACAACTCCTGCAGCTTTCTCCGAACATGTACGCCGAATCGAAGGTCAACCTGGCGATCTCTCGACCGA
GTCGTTGCCTCAAGCTGGTTCCTCGTTGCCGCCCTTAGACCAGATCACCATCCGGAGATCGTTGGCTGCAGTTGAAGCCGCTCTGGATCGCGAGAGTGAG
TTTCAGGCACTCCAGCGCAGCTACAACGACTTGTTGCAGTCCTACTTCGCCTTGCGACAACGTGTGGCAGACCTGGAGCACACAATTCGGTCGGCTCAAT
CACCGTCCCCATTCGTCTGCCTCGTCCAGCAGAAGTACGGTCAGCTGTCCCATCGTCTCGCGCAGTCTATCCTGGACTTAGCGGAAACCCGAGAAGCTCT
GGCCCGGAGACTCGACAATGCAACCGAGCTCACCAACCTCCGTGATCGTATGCGCCTCCAAGATCACGTACACGCGGAAGCAGGGAAATCGACGATTTGG
AGCGGCGTCTAACGGCCGCATTGGCAGTTGCCAGCACGACTTCTGGTGACACAGCTCTGCCTCCGCCTGGGGTCAACCCGACCACCCTTCAACTCCAATC
CCAGCTGAACGTGGCGATCGCAGCCCAAGGTCTAGCGAACCGCGATCTGGATCAGGCCCGCGACTCAATTCGCGATCTCGAGACCTCCCAGAAGGCTCTC
GAGGGATCGGCGCAGATCCTCCGGCAACAGGTGGCGCTACTCGAGCGTCGTGCGTCCGAATTGCGCGACCAGTTGGCGCAAACCCGACACGGTTCCCGGC
GTGCCCTCGACCAGAGTCTTCAGGAACGACAACGGCTGCAGGACCTACTGGACAAGTCCGACCAAGATCTAAGCGATCAAGCGGCGAAACTACAACGGGT
GACCCAAGAACGTGATCGCGCTCGGAACGAGCTTTCACAAGCACGTACGTAATCGCGTCGATACTTCAGCGTCCGTTGATCTAATCCCGTTTCTCTTTCT
TGCAGGTAACCAAGTCACATCCGCCCGCCTTTCCATAGCTCGGCTGGAGCAGCGAGCAAGCAGCCTCCAGTCTTCGGTAGCCGCCAACCACCAGCTGAGC
AGCACTAATGCCGTGTTGCGTGCTGACCTCGCGACCGCCCGTCAATCCCAACAAGATCTGGAGAGCGTGCGTGATCAGCTGATCACAGAGCGAGACGGTG
CTTTGCGGCGCCTTTCGGACATCACCAGCATACTTCAACCTGGCTCGATCGTTCCTCCGGCGACTCCTGTTCCCACGCCAGCCAGCGATCCCTCCCTGCT
GAAAAAGGTTCCATCACGGAAACGTCTCGCCAGCCGCTCTCCTTCCCGTCGCTCTCCATCAAGTCCGTCGTCTCGTCGCAAGCGGCCTCACAAGTCTCGA
CGTCGCCGATCTCCTTCATCCGGCGACAGCGACGATGATGACGCTCTGAACGCCGGTCTCGCTCGATCGCGTTCTTCTAGTAGACGATCACATTTGTCCC
GATCGAAGCGTCGCGCAGCAGGTACTCCCAGCAAGCCGATCAACGTCGACTCTTCTAGCGATCGTGGATCGGATGGCCAAGCCAGCGACGACGGCAATAA
CGACGATGGCGGTAACACCGGTGACGATGACCGCGATAACGACGATGGCGGTAACGCCGGTGACGGCGACCACAATGACGACGGTAACGACGGCGATGAC
GACGATGATGATGACGATAACGACGGCGACGGCGACCACAATGATGGCGGTAACGACGGCGATAACAAAGACAGCGACCACGAGGGCGACAACGACGATG
ACGGCGGCGGTGACGGCGGCGGTGATGGCGGTGACTCGTCCGGAGGCAGCTCCGCCGGCGACCACCACTCGGGCGATTCCGATAGCAGCGATTCAGCGAA
CTCTGTCTTGTCCGATGCCGAGCTCGATCAGCTCGATCCCACCACCATCTCTCGGGACCGTTGGATCCCAGGGTACCGGAGTCCTGTAAGGTTCGCGGGT
ACGGACGTGGACCCTTGGCCTCTTTCTCCGGTTCGTCAACTCAGCGTCCGCCATTTGACGGTCGCCACGTTATTTCGTCAGTGGAGTCGTCCGCCATCTT
GGCTATTCCCGCGTCGGACCCGCACTCCTTCTGCTGGCACCTGGAATCCCGACTTGATCACCCAGGCTAA