Transcript Name :
Phyra_g7110
Orientation:
(-)
Number of Exons:
7
Description :
hypothetical protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
fprintscan predictionP-Valprediction_id
Ankyrin repeat0.00000011PR01415
Ankyrin repeat0.00000011PR01415
Profile scan predictionP-Valprediction_id
Ankyrin repeat-containing domain117.233PS50297
Ankyrin repeat8.87PS50088
Ankyrin repeat9.725PS50088
Ankyrin repeat13.598PS50088
Ankyrin repeat11.327PS50088
Ankyrin repeat10.659PS50088
Ankyrin repeat11.701PS50088
Ankyrin repeat14.345PS50088
Ankyrin repeat13.945PS50088
Ankyrin repeat11.194PS50088
Ankyrin repeat11.861PS50088
Ankyrin repeat10.045PS50088
Ankyrin repeat8.95PS50088
Ankyrin repeat12.583PS50088
C2 domain14.985PS50004
HmmSmart predictionP-Valprediction_id
Ankyrin repeat630SM00248
Ankyrin repeat16SM00248
Ankyrin repeat0.000058SM00248
Ankyrin repeat0.15SM00248
Ankyrin repeat0.00047SM00248
Ankyrin repeat0.00032SM00248
Ankyrin repeat0.00000062SM00248
Ankyrin repeat0.0000032SM00248
Ankyrin repeat0.00029SM00248
Ankyrin repeat0.01SM00248
Ankyrin repeat0.018SM00248
Ankyrin repeat0.11SM00248
Ankyrin repeat0.00063SM00248
C2 domain0.00000000000097SM00239
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
Ankyrin repeat-containing domainIPR020683
*** None ***
InsideOutsideTMhelix
1-929
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
protein bindingGO:0005515IEA
*** None ***
*** None ***
Sequence
        11132 bases(100 bases per row)
TGGACTCCAAGATCCCGGACGACAGTCGGTGGCACTCGAGGCACGAGGGCGACTTCATCACCGACGACCGCCTGGCCGACCACTTTGTGGGCAAGTTGCG
CGACGAATGTCGTGGCGAAACAAGCGAGGTGGCCATCATGGTGCGCTTCACTCGCATTTTGAAGGAGCTGCTGGACTCGTACGAGAGCCAAGCCAATTTG
CTGTTGAAGCTGGCGGACACGGGTCGGGTGACTACTCTGCTGCACCAATACATTGACAATGCACTGGATATGCTCAACATTCTCGACCAAGAGGAGCGAG
AGGTTTGGCACAGCAAACTCCTGCAAGAACGCCAGGAGCGACTGAAAGTTTTCGAAGCCTTTGTGAAAGACGAGGAGCAGCTACTTGCTGCTTTCGGCAA
CAAGAACCAGCAACTTGAAATCGTCACGTTGCTGCGCTACTGTGTCAAAAAGTATCATGACGGCCTGACACCATTTGCTGGTGCTGACGAGAAATACCGA
GACAAGTTGACGGAGGGCGAGCTGGACACGCTTGCGATGGTCTATGAGCTGGTTGTGAGAAAGACGAACGTGGTGTCAGGGAAGCCGCCCGAGTGGTTTT
TCACCTCCGATCACGAGTGGGCGTGGGTGAACAAGGCCAAGGTTGAGGACAGCAAGGGGGCCTGGGACAGCAAAGCTCGAGCAAAATACACGGATGGAAA
TGCGAGTGATCAGGTTCGGGGAGAAATAAGCGAGGAAGTTTGTGTTCGACTGGCATCGATCTGGACAGAGCTCAACCACCCGCACCTGCGCAAGTTTTAC
GGCGCCTCTCACGTTGGCAAACCTTTCGTCATCCACGAGACCTGCTTTTCGCCCAGCTACGAGATGGATCTGTGGCGTTATGCGGCGAATTGCGCTCGTG
GTCTCCAGTATGCGCATGATCGAGGACTAGCGTACCATGATGTGTCGCCATCGACATTCCTCTGCAGTTATTCGGAGCGCAGAGGTGTTGTGGATGGACT
GGGACTTGTGCCGAGGAGCGAAGCCGATCGGTCTTTTCGAGACACGAATCCAGCCGAGTCTCCGGTGACTCACAATGTGCTGCGGTTTGGCATTTCAGTC
TTTTTCCTTCTTGTTCGTTCTCGCAATTCCAATCAGCCGTCGGACAAACGTGACGAGACTTTTGACTCATGGAAACCTGAATCTACGAAAAGTCTTCCGG
ATGATCGACCGCAGTTTATCACCGAGGATGAGTGGCGTGTTTTGCTTGGATTGTGCAATCCAAGCCCGGCATCCAGAACTAAGCTGGCTGACGCGGGTTT
CATATCACTGATACCAGATGAAAACGGAGAGAGACAAACTTCAGCTGTTGAGGATGTAAGCAAGTACTTCGAGAAAGATTGTACTGTTGGCGGTGAAACT
CTAGCCGAAGTAATGCGTGGGATCAAGAACAAATGCAGACAAGCAGCCGGTTTAGACGCGGAGAAGAATGAACGCGTGTGCAATCGTCTCCATGACGTGT
ACACGCAACTCTTGAATTTATCCGAGCCGGTACCGTCCGGGTTACTTGATGAGTTTTGTGGACTGGCACGGGCTTTTCGCAAAACGGCTGATAAAGACTG
TCTCGACTGTTCTCGCTCCAATTTAAAGATTTCAAAGACGACAGGCAACATGAACTCCCGTTTTCACTACAGAATCGATCATCTCGTACGAAGTTCACCT
CTCCTCAATAAAAGAAACGCCTGGCACCAGTGGCAGCCTACGTGGCAACAAGCTCGGAAGGAGCAATTTACACTGTTTCAGTCGTGCTTGAATAACCCCG
AACAGTTTCTCGATGAGATTCCCAGCAACCAGTTGACTCAAGCTTTGACTACTATGCGCTTCGAGGCCCACAGCCGTTCTGGAGCTTATTCACCTGAAGA
TGTGGAAAAGATAAAGGTTGTCTTGGCTGCCAAAAAGATACCAACACTGCAGGGTGCGAAAGTTGGAGAAGCACTTCCCAAATGGTTTGTACCCGGCTAC
CAGATTGAGCTCGGAAAGCATATTAGCGATGGCGGATTTGGAACTGTGTACCACGGCAAATGGTTTGGAACGGATGTTGTGGTTAAACTGGATATTTCCC
CCGTCATCACTCCGGAGAAACGGGCAAAGTTCCGACAAGAAGCAGATCTGTGGTTCACGCTGAATCATTCCAACTTGATCAAGCTGTACGCTGCATGCTA
CGAGGGCCAGCCTTTTTTCGTCTGCGAGCGTGCAACGCGGGGTATCCTCCCCACGTATTTGAAGAGCAGACGCCACGAGACCTGGTTTCGTTTACTGCAA
GCAGCGCTAGGACTTCAGCACCTTCACGAGCACAACATCGTACATGGAGACTTGAAAGGGAATAATATTCTCGTTTGTGAAGGGGGAGCGACAAAGATTG
CCGATTTTGGGCTGAGCATTCTGGCCTACACTTCCGAGGATAAGACACTGATGACAGCTGCAGTGCAATGGATGGCACCCGAGTGCTTGAAAGGTAAACC
TCCTACCTACGCCTCGGACATTTATGCGTTCGGAATGTGCATCATCGAGGCTGTGACCGGGGAGCATCCGTGGGGGATGCTTGATAACAAAACTGTGACT
CACAAAGCGGAAAAGGGAGAACTACCCACACGTTCAGAGAAATTCCAAACTGAGGAATGGGATCTCATTGAGCGAATGTGTCGTCGTGATCCTACGCAGC
GCATCGGAATTGGTGCCGTTGTCAAGATTCTGGAAGATATCGGCGTGAGGAACTTGCTCGAAAGGTCTGGGATGATGGTGGGGGCAACCAAAGTTGACAG
GAAAAACGCAACGTAAGCAGCAAGTTGTGATGCCAGGACTTTGAGTGTAGTTTCAGTATGTAGAACACAAATATACAGAACTTGGACTTGCATAACCCAG
CAAGGCAACAATTCCGTCACGTGCAGTACTGGTAGCGACTCGTGGATATGAAACACGTGGTTTGGATTGAACACCATGCCGATCGCTTCGCAGTTGTCAA
GTTGCTTACTTCGTAAGGCGCGTCTTTCGATCTCGCAGACAAAGTCGGCGATACCCCTCTCATCGAAGCAGCCAAAAGTGGTAATGCTGCGTTGGCGAAG
GTCCTGGCTGAAAAGGGTGCCTCGATGCATCCAGTTAATAGTGCTGGGCTAACTGCTCTCGTGGTTGCCGTGTAGAACAGACACAAGGAAGTCGTGAAAG
TACTCTCGGAAAAGATGTCCAAATACGAATATGTGCTAGTCTCGTTAATTAAACACGCACCTGCCAACAGTGGGTACAATATGCTGGCTCATGCACGCGC
TCTGGCCACTATGCTGCCATTCTTCAATTTGCGCGGGAGACGTCGAGCGGGGAGAGATTTGGTGAAAGTGTGCTTGGAGATGCCACAAGTCATGGCACGA
ACCAGAACTGATGCGGAAGGTGCGGTTCAAGACCAAGATGTGAAGAATTGTGCTGCACTGGAAATACAAGACGAAGAATTGACGATGCACCTCGAAGTTG
AGAGCTCGGACAAGAGCAGAGAGCTGTTCACAGCGTGTGAGGAGGGAGAGCTCGAGATTGTTCAGGATCTTTTAAAACAGGGTGTTCCAGTTGATACAGA
AGACGACGACGGCAACTCCCCACTGAAGTATGTCTCTCAATACGGACACGTCGCTGTGGTGAGATTTCTGCTGGAAAGTGGAGCTTCTGTCGACTTGGCA
AATGATGCTGGCTGGACTCCACTGATGAGTGCTTCTTTTGAAGGGAATGCTGAGATTGTGCGGCTTCTTTTGGATCATGGAGCGTCCCCGGACAAGCAAT
CTCCCGACGAGGCTACTGCTCTCCATCTCGCATGTGAAGAAGGGCATGCTGACGTGGCTAAAGTGCTGCTGGAGAATGGAGCATCCATTGAATGTTCAGA
TGAGGGTGGTAGTACTCCTCTGATAGTGGCATCCGAAGACAACCACGCAGAAGTTGTTCGGGTACTCTTGGACAATGGAGTTTCAGTTGACACGCAAGAC
GCAGAGGGAACGACCGCTCTCCAAATGGCTAGCCAAAATGGACATGTCGACGTGGTGAGACTTCTAGTCGACCATGACGCATCGATAGACTTGGGGGATG
AATTTGGAGCCACCCCGTTGATTCTTGCTGCAGAAAACGGCAAGCTAGATGTACTCGATGTTCTCATTCAGAAAGGTGCATCGATCAACTTGAGTAGGGA
TGGAGACTGGACTCCGCTCATGAAAGCCGCTGAGCGAGGGCAAGCACTTGCCGTAAGGATATTGCTACAAAACGGAGCTGAGATCAATCGTTCACGACCT
ACTGGTGCAACTGCTCTGAACATCGCTTGCGAACACGGTCAGCTGGACGCTGTTGTAGCTCTTGTGAACGCTGGAGCGGACATCGAACTGGCTGATGAGG
GAGGGTACACGCCATTGATCACTGCAGCTCAATTGGGAAAGTCTGATATCGTCCAGCTCCTGGTGAATCGAGGCGCCAACATGGATGCACAATTGCCCAG
CGGGAGTACGGCCTTGCTCACAGCAGTCTGGTACAACCAACTGGCGGTCGTTCGGATTCTCTTGGATAGTGGAGCAGACATCAATCTGTGTGGAGATTTT
CGGAGCTGGTCACCGCTGCATGTGGCATACTTTAGCGGATATGCCGAGTTGGTGCACCTCATATTTGAACGAGTCCCAGCCGAAAAGCAATTATCGTTTA
CAGAGTTGGTTGATGCCCTCCCTCCCGCTAAAACTTCTTCAACAGCAACCCACGAACCCGTGAGAAATACCACGGTCGACGAGAAACAGCGAAATGGAGA
CACTGCGCTTCGAATTGCATGTGAAGAAGGTGAGTTGAAGAGTGTGAAGGCTCTTCTGGAAAGAGCGAGCGACATCAACATGCCAGATGATGAGGGTTGG
ACTCCGATCATGAGCGCTGCCGAGTGGGGCTACACGGAAATTATCACTCTACTTCTGGCAAAGGGGGCAAATGTTAACCAGGTGACGCAGGATGGTACGA
CTGCTCTTCAGTTGGCCTGTGAGTACCAACAGCTGGATGCTGTCAAGCAGCTCGTCGAGAATGGTGCATCGGTTGATCTGGCAGACGAAGATGGCCAAAC
ACCTCTCATGACTGCAGCCCGAAACGGATTCATGGATGTGGTAGAGGTTCTTCTGGCCAGGGGGGCGTCAATTGACACGCAACGCTCAGACGATGGAGCC
ACCGCCCTCCGCATCGTATGCGCCGATGGCCGTCTTGATGTTGCTAAACTTCTCGTGGCCAATGGTGCAGCGATTGATTTGGCAGACGACAGAGGCTACA
GTCCGCTGGCGGATGCAGCGTACAACGGACATGCTGGTGTGGTGAAATATCTAGCAGACAATGGAGCTTCTGTCGACTTGGTCATCAGTGAAGGCTGGAC
TCCGCTCATAACCGCCGTATATATGAAGCATGCCGCTGTCGTGAAGGTGCTTCTTGAGAAGGGAGCAAGCGTTGACAAACAGCGTGACGGGGGACGCAGC
GCTCTCACAATGGCGTGTCACCACGGACGTCTCGAGTTTGTGAAACTCTTGGCGGAAAGCGGCGCATCCATTGAGCTAGCAACTGGCGAAGGCTATACCC
CACTCAGCATCGCTGCGGCTCAAGGCCACCCTACTGTGATAAAGTATCTGCTGGAACTCGGTGCAACCACAAATTTGACATCAAATAACGTTTGGACCCC
ACTCATGAGGGCCTCCGAAAAGGGTCACGTGGATGTGGTGGCGTCACTTTTGGAGCATGGAGCTGCTGTGGATAAACAGTTTTCGAACGGGTCGACTGCG
CTTCAAGTGGCTTGTTCCAATGGACAGCTGGAGGTGGTAAAGTTACTCATCGACCACGGTGCATCGATTGACCTGGCAGACAACGACGGTAACACCCCGT
TGAAGTGTGGATCTGATAGTGGTCATGTGGAGGTGGTGAAGTTGTTACTGGAAAGGGGAGCCGCTATGAACCTGGCTAACAGTGCCGGTTGCACTGCGCT
GCAGGGATCTTTGGAGAGAGGTCACAACCAAGTCGTCGAGGTGCTACGACAGGCAGGCGCAGAGCACGATTAAGCGTATTCTGTTGCTGGTGCCTGTGTT
GCTAAAGTTTTTTTTATTAAAATACATGTTGAACTGAAGATCACAGTCTTTGGCTACAAACTACCTTTTGCTGCATCTATGGCCATGAATGAAAGTGTTC
AAGGTCACCCCTGTACCCACCAGGTTCGGTCGACACGTCATTCTTCATTTGCTGTCCGATGCCAAGAACCAGCACGACAGCCCAACGCCGGGTCGCTGAC
CTGCAAACCGCGTGTAGTGATGGAGAATTGAAAGTCGTGAAAGCTTTGGTGAGACGTGGGGCTGCTGTCAACTGCACTGACGAAGACGGCGACACTCCTC
TGATCCTTGCTGCTGAAAATGGCCACCTGGATGTGGTAAAGTTCTTGCTGAAAAATGACGCATCGATTCATACAATGAACAAGGAAGGGTGGACAGCGTT
GTTGCAAGCTGCAGATGAAGGCTGGGATAACGTCGTGAAAGTGCTCCTGAAAACTGGAGCGACAATGGATATGCGTCTACCGAACGGCGATACCGCGCTG
CATCTAGCGTGCGAGGAAGGCCATGAGGACGCTGCCAAGATTCTCATTGCCAATGGTGCCGAGATCGACGCTATAAACGAAGTCGGCAATACTCCACTGA
TGGATGCGGCTGAGAACGGACATGACGATGTGGTGAAGCTCCTGCTGAAAAAGGGAGCGGCCATTGATGCGACGAACGACGAGGGATGGACGGCTCTCGC
TCAGGCTTCAGCCGAGGGTCATGAGGACGTGGCTGCGCTGCTATTGAAGAAAGGAGCTAATATCAACAAGCCGTCGCCAAGAGGAGAAACGGCGCTTCTT
GTCGCCAGCAAGGAAGGACACTGCGACGTTGCAAAGCTCCTGGTTGCGAGTGGTGCATTGATTAACTTGGCGGATGAAGACGGCGATACCCCTCTCATAA
ATGCCGCTGAAAACGGACATGTAGATGTGGTCAAGCTTCTATTGAAACGTGGAGCGTCCACTGACTTGACGAACCATGAGGGGTGGACTGCTTTGATGCA
GGCCGCAGATGAAGGCCACGCTGGTATCGCAAAATTGCTTATCAAAAAGGGGGCAAACGTGAAGAAACAGCTGCTGGACGGCAAGGATGCCCTTCAGCTG
GCGTGTGAGGAGGGCCATCTCGCTGTTGCGAAGATCCTCCTCGCTAGTGGTGCATCTACTGCCCACACGGATGAAGACGGTGATAGTGCGCTGACATTTG
CAGCCACAAACGGACATACCGACGTAGTGGAGTTGCTGTTGAAGAGTGGGGCTGAACTTGACCTGGTGACGGACGAAGGTTGGACTGCACTAATGGGAGC
TTCGGAAAACGGTCACTCAGATGTCCTCGAGATATTACTGGCGAAAGGAGCAAAAGTGGATAAGCCGCTTCCAGACGGCCGGACTTCACTTAAAATCGCT
AGTGAAAATGACCGCCTCGAAGCGGTCAAGCTCCTCCTCGATCATGGAGCCTCGATTGACTTCGTGGACGAAGACGGCGACACTCCACTTTTCGGAGCAG
TACAAAACGGGAATACAGACGTTGTCAAGCTTCTCGTCGCGCGTGGTGCGTCTATTTTTCAGACGAATAATGAAGGCTGGACCCCAATATTGAGGGCTGC
GGAGCTCGGATATCCTGTTGTGGTCAAAACATTGCTGCAGGCAAAGGCCTCAGTGAATATGCGACTGCCTAGTGGCGCTACCGCGCTGAACATCGCATGC
GAGCACGGTCACTTTCCCGTTGCGGTGACTCTTGTGAACAGAGGAGCCGACATTGAACTAGCTGACGATGAAGGTTATACACCGCTGATCACGGCCGCAC
AATTGGGATACGCTGACATCGTCCAATTTCTAGTGAATCAAGGTGTAGACATGAATGTGCAGCTCCCGAGTGGGGGAACTGCCTTGCTCACCGCTGTGTG
GCACAATCGCCTTGAAGTGGTTCGAATTCTCCTGGACAGCGGAGCGGACATCAATTTAAGGGGAGACTTTCAGAGGTGGCCGCCTCTGAGCGTTGCATAT
TTCAGCGGATACACCGAGCTCGTACATCTGATCTACGAGCGAGTTCCACCCGCCAAGCAGCTATCCTTTGCTGAAGTAGTTTTTACAACCACTTCAGTTG
GCAAGTCTCGAATGAACTCTGATCCCCCAAAGAGAAACAACGTGGTCGACCAGAAACTTCGCAATGGAGACACAGCGCTGCGAATCGCGTGCGAGCGAGG
GCAGTTGAAGGTGGTTGAACGTCTGTTGGCGAGTACCGAAGCCATTAACATGCCAGACAGTCTCGGTTGGACACCTCTCCAGAGCGCTTCAGACGAAGGA
CACACTGAAGTGGTCGAGTTGCTGCTGAAAAAGGGGGCAAACACCAACCTGCAGCTGCCCAACGGTAATAGCGCCCTCCAACTTGCCAGCATGGAAGGGC
ACCTCGATATTGTAAAGTTACTGATCCAGAATGGAGCGTCTATCGACTTGGCAGATGAAGACGGCGACAGTGCGCTCACTTCAGCAGCTGAAAACGGTCA
CGTTGCTGTGGTGAAATTTCTGTTAGCGAAGGGGGCGGCTATCGACTTGGCAACTAACGCAGGCTGGACATCCCTTATGGGTGCGTCGAACCATGGCCAC
GCAGACGTCGTGAAGGTGCTTCTCCAAAATGGGGCAAGTGCAGGCAAAAAAGAAGGAGGTGGAGGCACTGCTCTTCATATTGCGAGTTCAAACGGGCACG
TCAGTATTGTGAAGATTCTCATCGAGAAGGCCGTGGCAATCAATACTGTGGATGAAGAAGGCGATTCTCCACTGATCGACGCAGCTGCAGACGGACACGT
CGCTGTCGTGCGAATTCTTCTGGAGAATGGCGCAAAAGTAAACGTGGTCAACACCGATGGTTATACTGCCCTCCTACAGGCTTCGGAAAATGGTCACCCT
GACGTAGTAGCTGTGCTACTAGAAAACGGGGCTCATGTTGACGAACAAGATCACGATGGTGATACTGGTCTGTTCCTGGCATGCACAGAGGGACATTCCG
ACGTCGCTAAGGTCCTCATCAGCAATGGCGCAGCCATTGACCTGGCAGGCAAAAATGGAGATAACCCGCTCATAAGTGCAGCTGAAAACGGGAATCTCGA
CGCAGTGAGACTGCTTCTAGGAAATGGCGCGTCAATTAACTCGCACAAGCACAATGGCTACACCTCGCTAATGGAAGCGGCGCTGAATGGACACACTGAC
GTGGTAGCGGTGCTACTAGAAAGTGGTGCGAGTATCGACAAGTGAGCTCCGAACGGGATGACAGCGCTTGGAATTTCGTGCGAGCATGGTCATTTTAGTG
TCGCTGAAATCTTGGTCCGCCGTGGTGCCGATATCGACCTGACCGACGACAGTGGCAACAGCCCGCTTATGATTGCGGCCGCGAACAACCACGCAGAAGT
GGTGAAGTTGCTTCTGACCAATGGTGCGTCCGTCGACTTGATCAATCACGCGGGGCTAACAACTATTGCGATAGCATCAGAGAACCAATTCGAGGAAGTG
GCGACGGTGGCCTCTACTGAAAAAGTAGTGTAGTGGGATGCTGTCGTGATTGAAACGTCGCGAGCATGAGCGAATTGTGCTTTTAATATTGTGGGGCTGC
GTACTGTGTGGGATGTGTCGCTGACCTCTGCTGCTGGCGCCGTTTGTTTGACGCTCCATACTCCGAGGCTTATAAAAACCCAATTTTGGGTTTATTTATG
TGCCGAAGTCGGTTTTATGCCGCTTCCTGGTGTATTGTATTGTGTGGTCTTTTCCAATAAAGCCGCGACTTCGCACGGAACAGATCTGGATTTACACTTT
TTCGATATTCTGGAGAACCAAACTAGGTTTAAGAGCGGATGTGTAAATGTAAATATTGACTTATACACTGTACTCTCAGGGGGGGGTGAACACTCGCGCG
TTGGTTCTCGTCTGCGAACTATTATAACAGCTGTGCGCCCGCCCCTCTCTCGCTGCCCTCGGCACCCCAGCCTCTAAGCAGCCAGGCGAAACGTGTGGGT
TAACCCTGCTGGATCTACCAACGCATCGTACAAACGTTATTTATGAGTACGGCAACAGCAGCAGCCGTCTCAAGATCAGGCAGAAATTCCAGCTATTACA
TGTACTACTAACAAGACGATCTGTGGTTTCTTCTACGGGTTTCATCAAGCTGCCCCCCCCCCCCCCATCATTTTGTTTTGGCCAGTACATGTACTGACAT
TGAAGGTTGCTAACTCTCCCGGCAGGGAAATACTCACTCCTTGCGCTGTCCTCGAAGGAAAAGCTGCACTGAATACAATTATGCCAATCACATCCACAAA
CATGTCATTAGGGCGATCGACCTCTTCGACCTCCACAAGATGCTGCTAACTCAGCTGGATATCGGAGATTGTAGCCATTTCCCTATGGCTAGGGGTACTC
ACCCCTGAGCATTACACACTGCGACACCGAAACAAACCGTTTGCCGGCGCTCCGTAGAGCCACAACTGCTTCATTCCGACTTCTACATCAGCTGCTCTCC
TGCGTGCCTCCAACCGCCCTCCTGCGCGCCTCCTACCGCCCTCCAGAGGCCGTCCCAGTGCAGTACAATGCCCATGACGCTTATGAACAGGAAGCACAAG
AAGTTCAAGGTGCAGGTGGTGCTCTTCAAGTGTCAGGACCTGGCGGCGGCCGACATGGACGTCGTGGGCGGCAAGAGCGACCCGTACGTGGTATTCACGC
TGGACGGGGTGACCCACAAGAGCTCGTGCGTCATGAACAACCTCAACCCGCAGTGGTCGCCGCCCGAGAGGTTCCAGTTCGAGGTGGACGAGTGGGAGAA
CGAGTTCCTCATCGCGCAGGTCTTCGACTACGACCGACTGAGCAAGGACGACCTCATTGGCTCGGCCGTCATCCCGCTCACGCTGTACGCAGGCAACCGG
CACTGCGAGATGTACAGCTACCCGCTGGTGCTGCCCGACGAGGTGGGTGGACTGGGAGCGCCCAAGAGCGACCTGTTCCTGCAGATCAGTCTCTCGGCCG
CGGACGGCAGCCCCGTCGAGTATTACTATTAG