Transcript Name :
Phypl_g1149
Orientation:
(-)
Number of Exons:
5
Description :
hypothetical protein PHYSODRAFT_505690
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
fprintscan predictionP-Valprediction_id
Isopenicillin N synthase7.9PR00682
Isopenicillin N synthase7.9PR00682
Isopenicillin N synthase7.9PR00682
Isopenicillin N synthase7.9PR00682
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-360
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
oxidoreductase activityGO:0016491IEA
iron ion bindingGO:0005506IEA
*** None ***
*** None ***
Sequence
        1378 bases(100 bases per row)
ATGTGGACCGCACGCCTCCGTTCTTCGTctcgcgcggcgctgggcgctcggagcttctcgtcgccgcgCGTGATGACGGCGtccaaggtggcgctgcagc
agctgccgctcgtggatGTCTCCCCGTTGGTGGCGGCTGCGAACAGCGGTCGTGAGGTGGCGCCCGAGACCAGGAcccagatcctggacgccATGCGCGC
TGCCTGCATCGAGACGGGATTCTTCACTGTCCCCGCTGAGGGAGTGCTGTCTAgccagctgctccaggcaGCGTACCGTCGAGCAGACGAGTTCATCGCG
CTGCCTGACGCGGTCAAGCAAAAGTACCATTGCAAGCGCTCGCCCAATGCTCGAGGCTGGACGCCCATGTTCGAGGAGCCGTCGGTACGTTGGGATTCGT
GGAGAATATGCTGGTGTGGTTTGAGTTTTATTCATTGTAGTGTTGTGGTGGATGGTACAGTACCAACCGGATGTGGTTTCGCACTTGGAGGGCTTCGACC
TCGCGCGGGAGCTCCCGGAGACGTTCGTGAAGGAGGGCTCGAGTTTGGGTCCGAATGTCTGGCCAGCCGAAGTGCCGCACTTTCGCGAGGACGTGTACGC
ACTGTACGAGGAGACCACCAAGCTTTCAATGATACTGTTCCAGAGCTTTGCGGAAATGCTCGGACTTCCGGCCGACACGTTCCTGGTACGCAGTGCCATA
TTTTCGAATTTGGCAAACGTTGTACTGACTTGGTTGCTGTTTGGGGATTTGTagcagcacgtggacgaAGAAGCGGAGGCATTCATGCGACTGCTAACGT
ACCCTGAGACGGATGCCCTCGTGAAGAATTCTACGGTTGGGATTGCCTCGCACACGGATTTCGAATGCTTCACTGTCATCCATCAGAACGGCGAAGGTTT
GCACTTGATGAACCGCCAGGGTGTCTGGGTTGAAGCTCCGGTGTGTGATGACAGGTACGGCAGGTTGTCGTATATTTGGAGATCACTCGTACACCATGAC
CAGCTTTACTTTTCCTACCACAGGCTCTTTGTCATGGTTGGCGACATGCTCGAGCACTGGACTAATGGCGTGCTAGTCGCGACTGAGGTAATGTACTCGG
CTTTGCAGTATTTTTAAGGGTAACTTTCTTTTTCTAGCTTGGTTGCTTGTCGTGCTTGTGTGTTGCAGCACCGCGTGTGCAACTCAAAAAAAAAGCGTCA
GTCGATCGTGCGCTTTAACGGCGCTAATGGCAACACCGTTGTAGAACCACTTCCACTGTTTGTGACACCGGAGAACCCGCCCCGCTACGCGAAAATGACG
CAGCGTGAGCATATTACCCACCAGATCCAACTCGcggagcagctcctgcagaaAACCAAGGCAGCGGCGCATGCGTGA