Transcript Name :
Phyra_g4385
Orientation:
(-)
Number of Exons:
1
Description :
POM73980.1 Hypothetical protein PHPALM_9113, partial [Phytophthora palmivora var. palmivora
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-281
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        845 bases(100 bases per row)
TGACAGAGCCACCTTCTGTGGTCCTCCAAGCAGTGAAAGAGTTCCAGGCCCTTGGACCCTTCGAGTTGGTGCCTCCACGACCAAAGGAGACTTCGTACAT
ATTCAAGTGGGGGGTTCGTGTCAAGTACATCGAGAACGAGAAGGAGGTCTTCGCGTGGGCTTGTTTGGCCGACGAGGCGTGTCGGACGTCAGGAAAAAAC
CTGTTCAAGCTCTATGCTGGCAAAACGACCATGGCCGTGAAGCACCTCCAGAAGATACACAACGTTGGCTCGCCGAAAACAAAGATAGCGACCGTCAAGA
AGCGCAAACACGACCATGATTACAACCACCTGTCATCGTCCGCCCTGTACTCAAACAACCCAACCCGGCTAAACGTGCTGATGACCACTCTCATGATCAT
CAACCATAACTTGACGTTTCGTATGGTGGAGTACGAAGAGGCAAGACTAATCCAAGCGCTACTCTATAAGGACGAGATGAAGGCCAAGATAACTACAAAG
CAGGTGAAGGAATCTATCGTGGAGCTGTATTCTTCAACACGCAAGGAGATCACTAACTACCTCCAAGAGAACCGAGAGGACTACCCGAACTTTACGCTCG
TGGCAGATTTTTGGACTTGCAAAACAACGCAAGACAAATTTCTTGGGTTGCGGGTTTACCTGGTGGACAAGGCCTGGGAGTACAAGTCCATTCTCTTGGG
AACGAGAAAGTTCAACCCCGCATATGGAGATCGTGATGGCGGCATTGTCAAGCCCTTCAAAGGGTGGTTGAAGCACATGCTCGAGGACTTTGGCTTAGCG
ACGAGCGATTTCTACGGGGCTACGAGCGACTCGGGGGTGACGTGA