Transcript Name :
Phypl_g1143
Orientation:
(+)
Number of Exons:
1
Description :
hypothetical protein PHYSODRAFT_361023
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-341
NN-scoreoddsWeighted Score
0.8514.6520.009
*** None ***
TypeScore
nuclear826
GO
*** None ***
*** None ***
*** None ***
Sequence
        1026 bases(100 bases per row)
ATGTCGACCACGCcgcagaagcaggagacgCATGAGATgcacgaggagcaggagcagacgTCGTCTCCCCCCACGCCCCCGTCGGTGGAGAACCAGACGC
AAGACACCGAGACGGGGGAGGAAGCCATGGccaccaaggacgaggagcacgagcacaAGGAAGAGAAGCttcaggaagaagaagacgagaagacgcagga
ggaggaagtgCAGTCGCCTGCAAAGGCTTCGACAcccgtggccaagaagacgctgtcggccTCCACGTCAGCCACCAAGAGGAAGTTCGACGCCCTCCAC
GCGCGCAACGCGGCGGGGGACGCTTCCATCTCGGAGcacgagaagaacaagaaggcTCGGGCCTCAGCTTTGATGAAGACGCCGGGCACGAAGAAGGCTC
CGACCAAGACGAGGGACTTCTCCTTTGCCAGACCGACAGCGTCTTCCGCCAGTCGTACAGCTGCCCTCGCTAGGGACCAGGCCaaggcgacgccgacgcc
tccGCCCGTCCGCAAGCCGCTGCATCCCAAGCGCACGCCTGCTAAGGTCCCACGTGCGTCGGAGCCGGCGCCCAGGACTCCCGCGATGACGGACAAGGCG
TCGCGCCCTCACGTTAGCTACACGCCGTACACTGGCCCGTTGCCGCCCTTGACCGTCGAATCCAGCTTTGCACCCAAGGGCTCGCAGATCTTGGACCGTG
GAGCGCGCACAGCGTCTCCTGCCAAGTCGAGAatggctgcagcggcttgcaAGCCCCGTCCGGcgtcggcgaagaaggcaaagcCGCAGGGCACGACCGG
TAAGGAAAACAATGGGGTGACCACGGAGGGAGGGGCAGCTACTAACGCTGCTGCCAGTATCAAGGCAAGCCGAACCCCCATCAAGTCCAGCACAACTGGA
TCGCCCGTGAGCAAGGAGCAGAACCGATCGGCgttcgaggagaaggccaaggcccAGCTCTTGGCTTCACAGCAGGCTGCGAGTCCCGTGTCGACGCCCG
CCGAGACTGTGGAACCCACGGTATAG