Transcript Name :
Phyra_g8930
Orientation:
(-)
Number of Exons:
2
Description :
XP_009523615.1 DNA photolyase [Phytophthora sojae
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
DNA photolyase, N-terminal36.497PS51645
*** None ***
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
DNA photolyase, N-terminalIPR006050
*** None ***
InsideOutsideTMhelix
1-518
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        1731 bases(100 bases per row)
TGAAGGTGGTCGTGTGGTTCCGGAGAGACCTGCGTCTGCATGACAATTTGGCGCTGAGTGCGGCGCTGCAGCTGATGCAGCAGCAGCAAGGGGTGGAGCT
CATCCCGCTGTACGTCATCCACCGCCCGCAGATCATGCGCTGCGGCGCCAACCGCTTCCAGTTTGTGCTCGAGAGCGTCCAGGACTTGGCTCAAGCGCTG
GAGACGCGCGGCTCGCGACTTGTGGTGGCAAAAGGAGACGCACTGCAAGTACTAAGACGGCTGCTTCCTACCTGGGGTGTGACGCACCTCATTTTTGATG
CAGTGAGCGAGCCGTACGCCGTGGAAAGGGACAATCGCGTCCAGACGCTGGCCAAGCGCCTGGGCGTACAGACGCAAGTGACCCACGGCTACGAGCTGTT
CGATTTGGATGCAGTGATCAAAGGTTATGGAGGCAGAGCTCCCAAGACTTACCAGATGTTCCTTCGCCAAGTGGGGAAGCAACGCAAACCGCCCAAGCCT
CTTCCCACGCCAGAGACGCTGCCTGCTTTGGCCTCGAAGCCCAGTGAACTGTACCAACTAGTTCTGGACTACTGGAAGGATAGAAATAAGGTGGACTACG
TGGTGAAACAGAAGGAGGAAGGAGGAGGAGGAGGAGGATCCGGAAGAAAAAAACAACCAACTTGATGAGATTGCGGGCCCTGACAAGCTGTTTACGCTTC
CAGAATTGACGGACTTTGGCTACGAGGCTATCAAGAGACATTCATTCCTGTATGGTGGAGAGCAGAAAGCGCTGGGCATTTTGAAAGAGTACTGCAAAGA
TGAAGAGCGTGTCGCCAAGTTTGAAAAGCCCGATACGTCCCCGGCGCAGATACCCCCGACGCCCTCGACGACAGCGTTGAGCCCATACTTGTTTTACGGC
TGCATGAGCCCCCGGACGTTTTTTCATCAACTGAAGGCGATTCAAGAACGCAGTAAAATGATGTCGCAGCCTCCTGTGAGCTTGGAAGGACAGCTTCTTT
GGCGGGAGTTCTACCATTGCCATGGTCATGCGAATCCGTATTTTGACAAGATGGAAGAAAGCCCAACGTGTCTGCAGGTCAATTGGCGTTGGCACATAAT
TCCTGACAAGAAGGAGGACATGACTGATGACGACCAGCTCGCTCGCTCGCAGTTCCAGGCTTGGAAAGAGGGTCGGACTGGTTTCCCTTGGATCGACGCC
ATCATGACTCAGCTGAAGGAGGAAGGCTGGATGCATCACTTGGCGCGTCACTCAGTAGCATGTTTCCTAACACGCGGTGATCTGTACATCTCGTGGGTGC
GTGGACTCGAGGTTTTCCAAGAGTACCTGATAGACCACGACTGGAGTCTTAACGCCGGCAACTGGCTCTGGCTTAGCAGCAGCTATTTCTTCACGGCCTA
CTTCCGCGTGTACTCCCCGATCAGCTTTGGCAAGAAATCGGACCCGGAAGGCCACTTCATTCGTAAATATATCCCGGCGCTGAAGAAGATGCCTGCCAAG
TATATCTATGAACCGTGGAAGGCCCCAATGACTCTGCAGCATGCCACAGGATGCATCATCGGCAAAGACTATCCGTGCCCAATTGTAGACCACAAGGAAT
CGATGTCCCGATGCGTGGCCGGCATGAAGATGTCTTATGCCAATGGCCAGTATGGTACTCCACCGGTTCCTGACCCCTCTGCTCGCAACAAAAAGCGTCG
GCGTGAGAACTCGGAGGCATCCGACGACTAG