Transcript Name :
Phyra_g13538
Orientation:
(+)
Number of Exons:
1
Description :
RAW26666.1 Transposon Tf2-6 polyprotein [Phytophthora cactorum
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Reverse transcriptase12.196PS50878
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-611
*** None ***
PositionContextScore
95KNARAAR|YA0.708
*** None ***
GO
Biological ProcessGO IDPrediction Method
RNA bindingGO:0003723IEA
RNA-dependent DNA replicationGO:0006278IEA
*** None ***
*** None ***
Sequence
        1835 bases(100 bases per row)
ATGATCTCAGTCCTGGTGGGGAATGACGCGGACGAACCTCCGCGTGCGTGCAACGTCGAGGTCGCACGTCCTCCATGCGACGCTGCCGAGATCACTCGAC
TGCCTGGCCTCTCGTGGAAACATTTCCTTCGCGACTTGAAGAAGGGCGAGATCGAACAAGTGTGCATGATCGTCGCCGAAGACGCCGCATCCATCGCAGC
CGTCGAGACCCACGCATCGGACTCAACGTCCGACGCTCGCACACGTCCGAAAGGTGCTGAGCCAAAGAACGCCCGCGCAGCACGATACGCTGCCCAGTCG
TTGCCGGCTCTAGAGGCTGCCGGCAACCCAGTCGCTCCTCTTGTACGCGAGTTCAGCGACATCTTTCCGGACAAGGTTCCAGCCGCCCTTCCACCCGATC
GTGGCGTTCGGCACGAGATCGACCTCGTGCCAGGCGCGAAGTACTGTGTGACGCGGCAGTGGCCGCTTCCCCGAGATCAAGTCGAAGCGATCGACGCTTT
CTTCGAAGGTCGCCGGCAAGCCGGCCACGTCCGCGAGAGTCTGTCCCCGCATTCCAGCCCGACGTTCTGCGTGAAGAAAGCCACCGGCGGATGGCGGATC
GTCCACGCCTTCAACAAGCTCAACGACGCCACCATCCCGGCGCAGACGCCGATTCCGAGGAAAGACATGGTGCTCGACACCATGTCCGGCAGCACCAAGT
TCAGCGCCATCGACCTGATGGATGGCTTCTACCAGATCTTGATGCGCGAAGCCGACGTGCCGTTGACTGCCGTCAGCACGCCCAGTGGAATGCTCTGGGA
ATGGCTCGTGATGCCGCAGGGGCTCAAGAACGCCCCTGCCACCTTCAATCGCATGGTGTCAAATCTGCTCCGGCCGTTCCGCGACTTTGCGCCCAGCTAC
TTCGACGACATCTTCATTCACAGTCGTGCCGCGGGCGGCATGACGGACGTCGAGATGCACCTTCAACACCTGAGGCAGGTGTTCGAAGTGATGAGGGAGA
ACAAGCTGTATGCCAACTTGAAGAAGTGCATCTTCTGCGCTCCCGAGATCCCAGTGCTCGGGAGCTACGTCAGCACGGAAGGTGTCCGTGCTGACCCGGA
GAAGATCGAAGCCATCTGCGCTTGGCCCGCTCCTCAGGATCAGAAGCAGCTCCGGCAGTGGCTTGGTCTCGCGACGTACCTCCACCACTACTCGAAGAAC
TTCGCGGCAATGATCCGTCCGTTGTCGCAGCTTCTGAAGGCAGATGCCGCGTGGTCGTGGCGTCCTGAGCACCAGTCGGCTTTTGACGCGGTGAAGACGA
GCTTGTCCACCGCGCCCGTACTCATGCTTCCAGACCACTCGAAGCCCTTCCATGTCGTGTGCGACGCGAGCGACTTCGCGATCGGCTGCGCCTTGATGCA
GTTCGATGACGAAGGGCGCGAGCGGGTCATCAGTTACCAGTCGCGCCAGCTGAAGCCGGCAGAGCGGAATTATCCGGTCCATGATAAGGAGCTGCTGGCC
ATGCGGTACGCCCTCATCAAGTTCCGCGTATATCTCCTCGGCGAGCAGACCTTCGCGATCTACACCGACCACGCGTCGTTGAGAACAGCGACGAAGAGCC
CTCACTTGTCCCAGCGCATGGCGCGCTGGCTCTCGCTATTCTCCGAGTACAACTTCGTCGTCCACTACAAGCCGGGCAAGGCCAACATCCTCGCCGACGC
GCTCTCGCGTCGGCCAGACTACGTGCAGTCGGTCGACACGCAGTTGGCGACGAGGATGACGACGAGTGCGCTGTGTGTGTTGCTGAAGAGGTCGCTGCAG
TGGAAGTCGCAGCGACTACTCCACTCCGAGACCTG