Transcript Name :
Phyra_g9583
Orientation:
(+)
Number of Exons:
6
Description :
hypothetical protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Protein kinase domain31.58PS50011
EF-hand domain12.561PS50222
EF-hand domain5.838PS50222
EF-hand domain12.84PS50222
EF-hand domain10.218PS50222
HmmSmart predictionP-Valprediction_id
Serine/threonine- / dual specificity protein kinase, catalytic domain1.4013e-45SM00220
Leucine-rich repeat, ribonuclease inhibitor subtype0.24SM00368
Leucine-rich repeat, ribonuclease inhibitor subtype26SM00368
Leucine-rich repeat, ribonuclease inhibitor subtype120SM00368
Leucine-rich repeat, ribonuclease inhibitor subtype14SM00368
Leucine-rich repeat, ribonuclease inhibitor subtype0.26SM00368
Leucine-rich repeat, ribonuclease inhibitor subtype1.5SM00368
EF-hand domain0.00052SM00054
EF-hand domain0.25SM00054
EF-hand domain2.6SM00054
EF-hand domain0.013SM00054
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
Leucine-rich repeat, ribonuclease inhibitor subtypeIPR003590
*** None ***
InsideOutsideTMhelix
1-1234
*** None ***
PositionContextScore
896SKSRSGR|AD0.517
*** None ***
GO
Biological ProcessGO IDPrediction Method
ATP bindingGO:0005524IEA
protein kinase activityGO:0004672IEA
calcium ion bindingGO:0005509IEA
protein phosphorylationGO:0006468IEA
*** None ***
*** None ***
Sequence
        9225 bases(100 bases per row)
ATGAGCGAGCGCGCGGCCGACGGCGCCTCCAAGCCGCCCAAAGAGCCCGCGGCCCAGCTCAGCGTGGACGACGAGATCGCGACCGTCATGACCACGGCGT
CCACCACCAAGAAGAAGGAGGACATGCGCAACGATAGCACGGGCATCACCGTGGGGGACTCGGCCCACACGCTGTCGGACGTGCGTGCTGACGGCTTAAA
AAATCGTCGCAGAAGAAGAACGAGGAGAACTGACTGTTTTTTTTAATTTTATTTTACGATCTTTTCTTTCAGGGCAAAACGATCCACTACTCTGCAGAGC
GGATCATCGGCAATGGCTCGTTCGGCGTCGTGTTCCAAGCTCAGTGGAAGAGACGGGCGAGATCGTCGCCATCAAGAAGGTGCTGCAAGACAAACGCTTC
AAGGTGGGGGAATGTTTTGTTTTAAATGTGTTCTTATTCTTCTACTGACGTTTATTTTAATTTATTATTGCTGTTGTTGTAAGAATCGGGAGCTGCAGAT
CATGCGCCAGCTGCACCACGTGAACATTGTGCAGCTCAAACACTGCTTCTACTGCAACGGAGAGAAACCAGACGAACTGTATCTGAACTTGGTGCTCGAG
TACATCCCCGACACGGTCTACGGCGTCGCCAGGCAGCTTCAGAAGGCCAAGCAGTACATGCCCGTGGTACTGGTCAAGCTCTACATCTACCAGATTTGTC
GCTCGCTGGCGTACATCCACTCCACGGGCATCTGCCATCGCGACATTAAGCCGCAGAACCTGCTGCTGGATCCCAGGTCTCACGTGGTAAAGCTGTGCGA
TTTTGGAAGTGCCAAGGTGCTGCAGAAGAATGAGCCCAATGTGTCGTACATTTGCTCGCGCTACTACCGAGCCCCAGAGCTCATTTTCGGCGCCACGGAT
TACACCACAGCTATCGGTAATTATTGCAGTTCTGTAGCTTAAAAGTGGTTCGTGTGCTGACGTGTTTTTTTTTCAAATTCAGATATCTGGTCACTAGGCT
GCGTGTGTGCGGAGCTGCTTCTGGGACAGCCGTTGTTCCCTGGAGAGAGCGGTGTGGACCAGTTGGTGGAGATCATTAAAGTTCTGGGCACGCCGCAGCG
TGAGGAGATCGAGGCTATGAACCCGAACTACACGGAGTTCCAATTCCCGCAGATTAAGGCCCACTCCTGGAGCAAGATTTTTCGTTCACGAACCCCTCCC
GAGGCTATTAATTTGCTGTCCAAAATGCTGGTCTACGACCCGAAGCGGTGAGACGTCGGAGTCTGATTGGGTACCTCTGTGGGCTCCACGGCTGACTCGC
TGTGTTGTGTGCGTGTGTGAAAACTAGACGTGTGAAACCGCTGGAAGCTGCAGCGCACCCGTTCTTCGATGAGTTGCGGCACAAGGATCTGAAGCTGCCA
AATGACGTCCCCGCGCCTGCACTGTTCAATTTCACGTTGCAAGGTACGCAAACAATATGCACATGTCTACCTATTACCGAGCCTGTGTAACCCGAGTCCG
TGTTGCTGTCATTTTGCACAGAGCTCTCGCAAGTGGACGCCGCAACGCGCGAGATTTTAGTACCGCTTCACGAGCGGAACTCCACCAACTGGCCGGTCTT
AGAGGACGGCACGTGGCCTGATGCGGCAGCTCACGGGACTTCCTGAAGGGTTGTTGTACATCAAGCAAAACATGAACGGCCCAAGGAGACAGCAATGGAT
TTGACCGAGGGAGAAACCAAATGTATTTTGCTTGTATCTTTAGTGGGCCCGGAGCTGTTACACGATTGATGGCTGTGGTTGTACAGTACCTACTAATTCC
GCACATTGGTGCAACCGTCCTGGTATCGCACGGGTGAAGGCACAGGTGATACATTTTGCAGGCCACGATCTCATAAGGTAAGGATGTTCGTGGTGGAACT
ATCACTGCTGACAACCTCGCGAATGCTAGTGAGCGGGTGCACTGCTGTCTGCCCAAGCAGTGTGCCTCAGGCCCATGGCGAAACCCTGCCGATGTGTGAA
GCCGTCGATTTCGAGTTGCTGCGGCACCTCAAGTCAGCAGTGCCCCAGCAGCGGAATCATGAGAGGCGAAAGGAAAGCTTACCTCCGTTCTGAGCTGCCC
CGTGGAAGGAGTCGGAGCCTGCTGCTGATCTGCTACTGTTGCTGAGTCCCAGCGAAGTTTGAGGTCGGACTCGCTCTTTCTCGGCTGCTTTGGCTTGCTG
GAAGTGCTCCTCCCACTCCTTTTTCGTGTTCTTGATGTCCTGCGTGGAATTTGGACGCCAATTTGTTAGTGGATGGTCAAGTCTCTCCCGCGTACTGTAG
ACCACGACACAGAAGCGTACATTTCGAATGAGCTCGAGTGAGACCTCATTCTGCAGAATAAGCTCTGTCAGCTCCACATCAATCAGCGCGGATTCATCGA
GTAGCTATGGCACATGTTCGTGAGGATCGTTCGCAAGATATCAGTGGAGGCTGCAAATCACCAGTATGACACTTACCTCTGAATGAGCTAACCGCTGGGG
GGCTGTCATGACGTCGTTTTGGTTTTTCGTCACAGTTGCTTCCTCCCCGCCTGGCGGTATTCGAGGAGATTCATGCATTAAGCGATTCTTCGGTCTCCTG
AGTTTGACGAAGCAGCATTTCTCTCAGCCGTGTGTTTTCCCTCTGCAGACTTGCATTGTGTTGCTGCAAGTGCACAAGACTCGGTGTTATCGCTCTTCGA
TGCCAGCTTGCCTTTTCTGACAGTACGAACCTCTAAAGATTTAACCCGCTTTGTTTCAAGCACACGAGTTGCGCTGGGGTCGCTTTCAAATACGGCCAAT
CGCTTCTTTAGGTCCTGAACCTGTTCCTGGAGAATGGGGATGTTGTTGTTCTCCGTCTGAAGGTGCTTGTTTTCCTCCAGCAACGATTGACTAACGGCAT
CAAGCTGATGTTCTTACACGTCGCCAGCGTTTCCTATCATTGTGAACGGACCCAACAGAAGGAGCAATAAGCAAACACGCTGGCCGACCGGAAGCACAGA
CACGTAAGTGCTTACCATCAATACTTCGATGTGCTTCAGCAGTTTTCGGATCGTTGTGTTGGGGTCTGACGGGTCTACACCAAGATGTGAAGTCGAAACA
CTGGGAGACAAGCTCAGTTTCTTTAAATCCCCCAAGATCGTGGATTCTGCGAGGCATCAGCAGCAGCCTCCACCTCTCTCCCTGACAACGGGTTAGCACT
GCGCATTTTATCGACAAAATTGGATGTTGTCGGAGAAGTATCGGTGTCAACGTCCTCGTCACTCGAAAGTTTGGCGTTGGCGTGGTTGGCGGCGGCCTCC
ACTTCCACTGTCGACATTTCACCAGCATCTTCGGCCATGTATTCCAACAAAATCGGATGATTGTTGAGAAAGTCATCGCGGAACAGGCGGACATTACCTC
GAGGCATGAGATTGCTCGCAAAAGGATCGGTTCCATTCGACTTGAAGCTCGCTGCGGTAAGGCTTCCACGAGACCCGGCGCCAGCAGGAGCTGTATATGG
CCGAGCTCCGATAAACCCGTTGTTTCCCTCTCGTGAGCTCTTGTGCACCGAGGCAAAGAACTCTTCGGTCAAGTCTTTATCAAGTTGCGTGACCTTGTCC
CCGTCTAACATCTTGAGGCGCGAAAGTACTCGCACTACCCGGAATTTGTAGCCTTCAACATCTCTTGAGCAGGGATTGCCACCCAAGTCCAATGCGCGCA
GCTACCATACAGAAACATTTAACACGCAATTTCGTTCAGTCTCGAATAGCACGCAGCAAACAATAAGGGGGTCATATTTGAAGCAAACCTTTGGCAGACC
TCGACACGTATGCAAGGCGAATCAAGGTCAGCTATCTGGTTTCCGTAGACAGACACTGTATTGAGCTCGAGCAGCTTGCGCAGAGGGCTAATGTCCACGA
TCTGTGAAGCATTACCATAGGTTCAGCCGGGCGCCCAAGTAATCTACAAACTACCACCTCAGCGCACAATCAACCTGGTTGTTGGCAAGGAATAATTTTT
CAAGCCCCGCACACTGGAGGTTATCGAGCGTCTCGATCTGATTGAAGTTCACATTGAGCTGCTCAAAACAAAAAAGCACCGCGTCAATTGCAACACCAAT
CTTGATCCCCTGACACTGGACTAGACCTCAATCAAGTTGACAAAGTGCTGGAAGTGCTCGAGTGACGCTAGTCGGTTGTGTGATAACGACAGTATCTCTA
GCGATGCCAAACTTTGCGCGCAAGTGTCATCCATATGTGCCACGTCTTCATCACGCAGAATCAACTAGAAGCATTGGCACAACACAAAACAGTTAGGTCT
CAGCTAAAAGGAGGGAACTGCTCACAAAACTCGTCACCTCCTTCAGCGCCAGAAGATCGTAGACCCCCGCGCGATTCATAACCACATCAGTCGTCAGTGT
TATCGCGCTGGAAGCCTCCACTGGCGGCCCCTGGTTAACCTCCATGGCGCAACTCCAGCGCTCGCAGCGACTGGAGATTACGACGCTTCAAGTTCCCCTT
GTGTAGCCACTTCAACTACGAAACGAATGCAAAAATGTAGCCATCTTATTTATTTTCAAGCGTGGCATCTCAGCAATGCAGTACAGGCGGGATGAAGTGC
CGGTTATTCGTCGCCCGAGCTCCCTCTCAGCTCTCGGTGAAGGTGTTGTGGGCTCAGGCGGACAGAGTAATCGACATGGCAAGTGCAAGGTGTCGTGGTA
TCGGTAAGTCTCCCACCAACTTGTGGCACGTGATGCTAGCGCTTCCAGGGGCTAATGCACGTTCATACAACCAGAAATTCCTTCGGAGACACTGTGCCGT
TGCCAGAGATGCCGCCTGAGCCATTGGCACTGGATCCGCCGATGGTGATCCCCCCAGATCTTCGACCTCTGGGCAGCAAGCGGCGATACCTGCGCACAAT
GCAGCTCCTCGCAGACCCTCTACCAGAGGATGACATGAACCGGAACGTGAGGGTAAGCTTACAGAAACTTCGCCGCCACGTCCGATCGGCCGATTGCTGC
GGCACCAAAACTCCATGTCGTCCAAGCGGCTACTCTCGAGCAAGAAAGAACGGAAACTTCTCAAGTCTGTGTCGCACAAGGACCTGGTGCTCGATCGCCA
GGTTTCGAGGCGGATAAAATCAAGCAACTACGTGGAAGAGAAGGAGGCAGAAATTGCAGACGCAGAAAGACAACATGTTCCAGCCACAGATGCAAGCGAA
GACACCATAGCGGCGGAGGCAGAATCATCCTCGGATACACGGTCGCTGGGCAACGTTCATCAGTACGTCTGATGCAGCGATCGAGTTGTGCATGCGTACC
TTACTTAGCCAAGCACCTTTCTCTGACGATCTTGTGGTTCTGTACTTTGTAGAGTCCTGTGACCAGTGCTGCAAAAGAACCACGTAAAGTTCATGGCGAG
CTTGATGGAGAAAATGCAACGGCAAGAGCTCTGCGTCTGCGCCGGATATCCAAGGAGGAGACTCTAGACATCCAAAGCAGTCAAGGGTACTTCGGAAAAA
CCGCGAAGCAGCAATTCTACGCACAGTACAAGCAGCTTTACTCCCGACCGTACCTGTTCATGGACAGTAGAATTGCAAATGGTGCGGCAGGTATACCCGA
CATGAAATCGTTAGCAGAGAGAGGTAGTGCACGTGAATATTTGGACGATACCGCTGAGAGCTCGATCATTCCGGCGTACCCGTCATCAATCGAGATGCGG
AAGATTAGTGAAGAGCTCAATCCATCATCAAGACTCGTGTCCAGAGTATCGTCGTCAATTATCATGGAGGACCGGCCAAAGCTACCCCTACGAGACAAGC
TATCGCCTCGAGCACACTTCTTGGCCTCATGCGCTGCGAAATCCCAAGTGGTAGTTCCCTTTCTCATCCGCAACAGGAACACCAAGGTTTTCGACTTCTC
GTTTCAATCGCTCGGGGATGCCTCCATCTCGGCATTTGCCAAGTCGCTCGTGCACGACCTGCCTCACGTGGAAGAAATCAGCGTGCGAGACAACCGACTA
ACGGACGATGGACTGAACGAACTGCTGCAGGCCGTGAGTGACGACAGCTCAACACTGAATCTCCGTTGTCTTGACATTTCCCAGAACCAAATAGGCCCCA
AGAGCGCACAGACATTACAATTGTATCTAGTGTCGCCACGATGTACCGTAGAAATGCTGCACGTGGACAACGCCGACATCGACGATCACGAATGCGCAGC
CTTCATGACAGCCTTCGAGAAAAACCAGTCTATCAAGAGACTCTGGATGAGCAGGAACTGCATCGGAAAAGCTGAGAACCTCAATGTCGTGCAGCCCGAC
TTCACGACCGGTGGCGAGGCCATTGCCCAAATGCTACACGTGAACACTGTGCTCGTTCATCTGGACCTCTCATGGAATTATTTACGACTCGAAAGCAGCA
TTGCCCTCGCAAACTCGATCCGCGACAATGGTACTCTCATAGAGCTGAAGCTCGCGTATAACGCATGTGCAGATGCCGGTGCTATGATGTTTGGCGAGGC
GTTGCGCTTTAACAAGACTCTGCAGGTGCTGGATTTGTCGTACAACAGCATCGGAGTGAAAGGTGCCATGGTGCTGGGAAATGCCATCCGCTCAAACCGC
GCCCTGCGTTCACTTCAGCTGAACGGGAACAACATCGGACGAGAGGGTGGTCAATTGCTGATGGCAGCACTTTGCGCGAATCAAACCGAGGTTGGATGCA
CTATCGAGCTGCACGCTTGCAATCTAGGAGCCAACATCATGCCGATTGGTGCAGCAGCTCCTGTGCTTCCCAAACCTTCTGCTGGGATCTCGGATCCTCG
TGGCCTTGCACCACATGCAAGCACTAATGGGGAATTCAACGTGCAGGACCTTCCGGTGTTTAATGCAAAGTCCACTCGGGTGTTCAATCCAAGAGAGCCC
GCTGGCAGATATTCACTCAACTACGCAACGCCTATGACAAGATGATCGCGATGGAGCTCGTTCGGCTTGCTACAACACGAAAAGGATGCCGCTTCTTGCG
AATTGAATACAAGACTCCGACGTCGTCAAAGCGGCCTATTACCCTCATCAAGAAGGAGAATCTCGTGGTTGAACAGCACAAAGGCGCAGGGGCTCACCGT
AGCGCAGAGAGCAACGGAGAAGAAACCACGCTTGAGACCAGAGGGCTAGACGCGCTATTCGCCAACGTAGACCGTGACAAGTCCGGGTACATTGACCAGG
ACGAGCTCATGGCGGTTCTCAATCAAATCGGTCTCTTCCCCCGGATGGAGAGCCTGGAGTCCATGCTGCAGAAGTTCGACTACAACAAGTCGGGCTTCAT
CGACGAGGGCGAGTTCAGTGCGTTCTTCTTCCATGCAGTCTTCCAGATGATCGACGAAGACCAGTCCGGCAAAATCGACGCGGACGAAGTCGAGGAAGCG
TTTAAGATGCTGGGCATCCACAAGTACGACGAGAACGAAATCGCCAACGCTATCACCACGTACGACATAAGCGGGGACGGCGAGATGGAGGAGTACGAGT
TTGTAGAGTTCATGAAGAGCAAACTGCTGGAGCGGATCAAGAACAAGCTGCTTGGTTACGATGGAGGTGAAGATGATACCGGAGACCAGGATAGGGTCCC
GCTTGTATCACTGCTGGATGCGTCGACCCAGAAGCCGTGGATAATCCCCGAAGACGGCCAACTAGAGGTCGACTTCCTCTATGACCGCGAGGCGTTTGCG
ACGAACGATGAGGCCTACCGACAGGGCAAAATCTCTCGGGTAGGTCTGGAACTCCTGATCCGAAACATCACTGAAGTCGCTACGTCCAAGTCTGAACAGG
ACGATCTCTTTCATGTGGCCATGTACGACTCGGAGGTTCGGCTCACGGCAGCGCAGGCGTATCAGGTTCTTGACGCTTGCCACTACCTCAAGCCTGAAAG
CAAGAAGATCGAGACGATCGCACTGCTGCTGCCACAAATGCTGACGGCTAAGGAAGCGCAGATCCTCGTAGCTCGAACCTTGACGCTCATGCAGCGGTGT
CGTCTGAAGGCTCGTATGGGCAGTGCGTACTCCGTCGTGCTCGGGAACCCGACGTCTCACTACTCGTTCGATCTCGCCAAGCACAAAGACCGCATCGCGT
TGACCAAGCTGGCTGAAGTTGCTCAGAGCGAGAAGCTCTTCTCGAAATCGCGCTCTGGCCGTGCCGACACGTCGCAGCACGGCAATTGGGAAAACTTTCG
CAACGAAGAGCTCGACGGCCGCAGTATCGTGCTCACCAACACCTTCTTCCACTCACTACCACGACGTGGCAAACTCTGCTTTGACTACGTGAGCACACGC
GTCCCAAGCGAGGCACCACGCAGATCAGTGAACGACGCTTTGACCAGCTCATTGAAATTCTCCAGATGGATGTCGTGCTGCCGGACGCGTTAGGTGCTCT
AGGCCCCACGCGATCTCAACGTGCAAGAGGACACCGTCAACCCAAGGCTGATGTAAGTGAGTCCAAAGCCGAAAAGGAGGAGAGCGAACAAGTGGCTGAG
CTAGCAGGGCCTCTTGCAGCCAAGTTGAAGCGTACAGCCTCCCAGGAGCAGTCTGCGTTCTGGAACAAGACGCGCGCCTCGATCCTCAAGCGCGGCTGGG
ACTTTGTCGTGAACCACGCGTACACGTTCCGCCTCACGGGCGCCACCAAGGAGAACGTGGGGCTCAAGATGGTGCAGATCGAGTCGGCCATTTGCGACCG
GTGGCTCTCTTGCGACCAGGCCTCCAAGATCATCGCGTGCATGCCGGCGACCTTCCACGCGCGGCCGGAGACGGCCCGCATCCTCTTCTCTCGGCTCATC
GACCTGCACAACTTCCACCGCATCTACGACGCCATGCCCAGGTCAGAGCAGCAGGTCTGCGCCAGTACGCTGGGCTGGCTCAACATGATGAACCCCATGG
CGCCCGAGCGCTTCTACGCGCTCAACTTGGCCGTGTACGACGAGCGCGAGATGACCAAAGTGCTGGTGGACTTGGCCATTGGCGAGCCGGGCGAGAACTG
GCTTAACCAGAACTTCACGCTCGTGCAGGGCGAGCCGGGCATCCCCGGCTGGAAGCTGCCCGCTCGCTGGGAGAAAGAGGACAACAAGGAGGGCGGCGTG
AACCGCGCGGGCTTCCTCGAGCTCGAGTACTATTCCGGCCAGGACCGCGGCTGCGCGCCCGTGGTCTCGCTGCGCAAGACGCTCATGAAGCGCGTGCTGT
GCGGCACCCGCCTGTACTGCCTCTA