Transcript Name :
Phyra_g9759
Orientation:
(-)
Number of Exons:
6
Description :
hypothetical protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
DWNN domain25.749PS51282
Zinc finger, CCHC-type10.345PS50158
HmmSmart predictionP-Valprediction_id
Zinc finger, CCHC-type0.0028SM00343
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-786
*** None ***
PositionContextScore
701AKERERR|GE0.591
*** None ***
GO
Biological ProcessGO IDPrediction Method
nucleic acid bindingGO:0003676IEA
zinc ion bindingGO:0008270IEA
nucleusGO:0005634IEA
*** None ***
*** None ***
Sequence
        3919 bases(100 bases per row)
TGTCGATCCACTTTAAGTTCAAGTCGGCCAAGGAGTTCGACACGGTGACGTTTCCGGGCGCCGTGATCCGCGTGCTGGACCTGAAGAAGGCCATCGTGGA
CAAAAAGAAGCTGGCCAAGGGCCTGGACTTCGACCTGGTGATCACCGACGCGCAAAACGGCAAGGTTTACGACGATGAGACCACGCAGCTGCCCAGGAAC
ACGAGCGTGACCGTGAAACGCATCCCCAGCCAGCAGCCTGGCAGCGGCCTGCTGGCCCGCATGAAGCAGGAGGCGGCCGTGGCAGCGGCCGCCGCAGCCG
CGATGGCCATCCACGCGTCACCGCCTGTGGCTCCCATGGCGGGCCCGTCGCCGGTGCTGCCGGTCGGGCCCACCCCCACACAGCCGTACGTTCTGAGGAA
TTCTGTAGTTCATTCTGTAGGAGAGAGGAGAGGTCAATGGCTGACGTGTTGCTGTCCTTGTGGTCACTTGTGTTGTCTTTGGTGTGGTCCTTTCCCCCTC
TCTTTTTGTACAGAATGGCCTCGTTGTCCTTGAGCACTGGAGACGCTGCAGGCGCGCAGACGATGGAGGACGAAATGGCCGCGCTGCAGTCTATTCACGA
ACAGGCAGAAGACATGCGTGGCTCGAGACTGGGCAATAAGACGTGGACGGCGTCCACCGGCAGCAACGCCAATCACGTGATGAACTACTACGCGGCCAAT
GGGCCGGGTGGAGATGCAGGTGGACGAGGAACTGGTGCTGGCGGTCGTGGATTTGGCCGTGGTGGCCGCGGTGGAGACTTTGGCGGACGAGGAGGAATGA
TGAATGGAAGAGGCGGGGGCCGCTCGGGACCTGGAGCCCCTGGCGGACCGAATCTATTGGGCAACCCGCCGCCCAACTATGTGTGCTACCGGTGCGGCAC
GCCCGGACACTATATCCAGAACTGCCCCACGAACGGGGATCCGGAGTTTGATCAGCACCGTGTGAAAAAGAAAACTGGCATTCCCAAGTCCTTCATGAAG
GCTGTGAGTGATCCCAGCGAGATCCCCGTAGGCGCGGGCAAAACGGTAGTGAACGCGCCGTGGGGCGGGCTAGCTGTGATAGAACCGCAGAATAAAAACT
TCTCTAAATTAATGGCCCGGTCCGGCGGCTCGGCCACCTTGGACCAATTCATCTCGAATCCCCCCGAGCACTTGGCATGTCCCCTTTGCAGACGGCTCAT
GAGCGATGCCGTGCTGATCCCGTGCTGTCAAGAGGTAAGCGACTGGCCAAGTTTTTTTCTGCTGTCTGCGGTGGATTCGTGTGAGGTGACTAACTGTGTG
GTTTGTTGTGTTTGCTTGCTTTCAGTCCGCGTGCGATGAGTGTCTACGCAGTGCGTTGATCGAGCGCAAGCTCACGTGCCGCTTTGCAACGTGAGCAACA
TGTCGCCCGAGAAGCTGTTGCCGAACAAGGTGCTTCGGACGTCTGTAGACGAATTTTTGCGGCGTGCGCGTACGGAGCAGCAGGAGCGCGAGCAGTTAGT
CAAGGAAGCTGAGGAAAAGGCTCTGGCCAAGCAGAAAGCGGCAGAAGTGGCCGCGAGTTCCGCTACACGCCGCTCAGGGGATAGCGCAGATGCTACGCTG
GAGATCAAGAAGGGCAAGAAGGGCGACGCTGAAGAGGACGAGGAAGACGAGTTTGGTGGTGACATTTTCGGAGATGGTGACGAGAACGAAGATGGCTCTT
CACCACAGAAGTCGGCTCTCCTTCGCAACCTCCACAACAGCCTCCGCTCCCTACGGAGGATGGAGCGGCGGCGACTGGCGAAGAGGATCTCGGTGATCCC
TCGCGGAAGGAAAGCGATGCATCATCTACTGGTAATGGCCAAGCAGCCGAGAGCACAGACAAGGGTTCGCCCAGTTCAAGATCCCAAGGACCCCTTCAGG
GAATGGCATGGGTCCTCCTGGAAGCCAGATGCCGTGGGGCCCTGACGGCCCTCGTGGGCCCCCAATGGGCTTTAATGGCCCGCCTGGCCCGTGGTTTGAT
GGTCCTCCCCGTGGTCAACCTGGGCCATGGTTTGATGGTCCGCCTGGCCCCTGGTTTGATGGACCATTCCCAGGTGGTCGTGGTGGACGTGGTGCCATGA
AGGGAGGTCGTGGTGGTGGCCGGGGTCGTGGTGGGATGCCTCCACCAGGATACTTCGGTGGCCCTGGTCCAGATTACTTCGGCCCTCCGCCTGGACACCC
CGACTACTTCGGTCCTCCCCCGCCGTGGTTTGATGGACCCATGCCGCCGTTTGGAGGTCGCGGGGGCGGTGGTGATCGCTGGTTTGAGGGAGGAGAACGC
AAACCGCCTCGTGGTCGCGATGAGGAACGACGACGCAATCGCTCCACTTCCCGTGATAGGGACCGCTCTCGTGGACGTGACCGGTCGACTGGCCGTGATG
GAAGAAGTGAGCGCGATCGCCGTGGTGGTGACGGAAAACCCAGCGATAAGGATTCCCGAGGTTCCCGTGGCAGCGACCGTGAACGAGAGCGTAGCAAGCG
TAGTCGCAGCCGCAGTCGCAGTCATAAGCCGGCACGTGCACACGGACGATCACGCAGCCGTAGCAAATCCCGCTCTGAGAAGAAGTCTCGTGAGCGCACG
AGCTCCTCGCGGGCTTCATCGTCTCGCCGATCACGCAGTACAAGTCGTGGTCGCCATCACCGCGAACACAAGAATGGCAACAGCAAGAGGACGCTAAACC
AGCCAAGGAGCCCGGGACCTCTAGTGATAAGGACAAAAAGCCGAAAGAAGAAGAGAAGAAACAAGAAAGCACGGTTAAGGACGTGAAGCTGGACCAGGTT
GCAGCACCTGCCATTGACCTTGACTTTTTGGCAGAACCAATGGACGAAGATGTGCCTAGCGACAATGAGACCCCGCGTCCTACGACCCCAGCCAAGTTAG
ATCGAAAGAAGAGCGATGAAAGCATGACAGACAAGGATACCAAGGACGCCAAGGATACCAAGGATACCAAGGATACCAAGGATGGCAAGGATAATGACAA
GAAGAGTCCTCGTGGAGACGACGCTCGCGATAAGAAGGAGGATAGTGGCCGCTCCTCGTCTCGTAGGCATGATTCCCCCACTCGTTCCAGTCGCGGACGT
GATCGTGATCGTGGGTCTACGTCGGAGAAACGAGGAGTGTCGCGGAGCCGCCGCAGTCGCTCGCGCTCACAGTCTCGTCGAGACTCGTCACGTCGGCGTC
CAGAGGATAACCGTTCATCTTCATCACGTGCGAAGGACCGCAGCAGCGGTGGGGATCGCGATCGTGAACGCGACCGAGAACGCAGCGACCGCGATCGGGA
CCGTGGACGTGATCGCGACCGTGAGCGTCCCCGTGAGAAGGACCGACCTCGAGATCGCGACAAGAATGAGCGCGAACGCGATCGTCCTCGCGACCGCAAA
GAGCGTGATGGAAAGCGCAGTCGCGATGCCGCGGACGGAAAGCGCGGGCGCGATGCTGCGGACGATGGCCGCAAAGAGCGCGATGAAAAGCGAGGTCGCG
ATGCTGCACGATGGCCGCAAGGAGCGCGATGGAAAGCGAAGTCGTGACGCTGCGACGATGACCGCAATGGAAAGCGCGGTCGCGATGCTGCGGACGAGGG
CGCCGCCACTGGAGGTGATCGGAAACGACGTCGAAGTGTGGAGAAGGAGCGCGAGCGTCGCGGCGAAAAAGGTTCCGGTGGTGGCGGTCGTGTAGTGACA
GCGACATCGGGTTCGTCTCGCGGCTCGCGCGGAGGCCGCAACCGCCGTCGCGGCGGTGATGACGACAAGCGGCGGATCGAGGCGGAGGCCGATGGCAAAG
GAGGTGGCAATGACCGCAAGAGGCCCCCACGCAAGAAAAGCGACGACCGTGGCAAGGCTTCGGGCGAGACCCCAGCCAAGAAGAGGTCAGTGCTGGATCG
GCTTGGCCCCAAGCTGTAA