Transcript Name :
Phyra_g8384
Orientation:
(+)
Number of Exons:
3
Description :
hypothetical protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Tetratricopeptide repeat-containing domain11.45PS50293
Tetratricopeptide repeat7.641PS50005
Tetratricopeptide repeat-containing domain43.822PS50293
Tetratricopeptide repeat6.136PS50005
Tetratricopeptide repeat9.381PS50005
Tetratricopeptide repeat10.797PS50005
Tetratricopeptide repeat8.909PS50005
Tetratricopeptide repeat9.883PS50005
Tetratricopeptide repeat8.231PS50005
Tetratricopeptide repeat7.788PS50005
Tetratricopeptide repeat6.638PS50005
Tetratricopeptide repeat8.201PS50005
HmmSmart predictionP-Valprediction_id
Tetratricopeptide repeat1.7SM00028
Tetratricopeptide repeat2.2SM00028
Tetratricopeptide repeat0.49SM00028
Tetratricopeptide repeat0.00086SM00028
Tetratricopeptide repeat0.079SM00028
Tetratricopeptide repeat0.06SM00028
Tetratricopeptide repeat0.24SM00028
Tetratricopeptide repeat170SM00028
Tetratricopeptide repeat150SM00028
Tetratricopeptide repeat64SM00028
Tetratricopeptide repeat10SM00028
Tetratricopeptide repeat4SM00028
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-1634
*** None ***
PositionContextScore
734SQSREER|AV0.503
*** None ***
GO
Biological ProcessGO IDPrediction Method
protein bindingGO:0005515IEA
*** None ***
*** None ***
Sequence
        9347 bases(100 bases per row)
ATGCGTCAAGTCAAGTCGCTGGTGGAGCTGTCGGTGGTGGCTGCGGCGCTCTCCACGCCCGTACAGGAGCTCCTGGACTATGTGGAGCTCCTGCCCATCG
CCATCCGCCACCAGCTCTTCCGAGAGTTGCCCAACTTCCGACTGCGCGAGATGGAGGTGGCGTGGGAGGCGTCTGTCCAGCTGGGGGAGGCCCCGGAACC
GCGCGACGGCTTCGACCCCCAGGCGGGTGACAAGTTCCTGTTTGACCGAGAGACGCAAGGAGTGTGGGAGCTCCGCATGAACGCAGCAAGACTGGGCTAC
GAGCCGATCCCCATCGAGAACACGGCGGCGGCCCAAGGACGCAGACGCAACCACCGGCACATCTTCTGGGAGCACCAGTTCCGCACGTTGCTCAAGCTGC
GCACGCCACTCGATTTTGCAGGGCCTGTCGACGTGCTCACAGAATGCCAGAAGCTCTTTGTGGACGTCGTGGAGGTGCTGAAAGTGCACGGCCGAGAGGT
CTGTAAGGATAATGTGGGGCTGGTCTTGGCGCTTCGACGGCTGCGACGACTGGAAGTGCATCATCCGGAACAGCAAAATACGTCCTGGGAGTCCATGGGG
AAGTTGATGCAGGACCACCCACATCTTACTGAACTGGGGTTCTTCCACGGCAAGTTGAGTGATAACCAGATCGTGCATATCCGCAAGACGCTGGCGAATC
CGAACCTGACGGTGGACAAAAGTCTGAACTGCAGCAGAATCACGACGCTGGAGTTTGTCTCGGTGAAAATTCGACCTGAAGGGTATCGCCAATTGGTGGC
CCTGGTGATTGACATGACGCAGCTAACCAAGCTTAGATTGAGCAACACTATCACGGATTTCGACACGAAGCTGCTTGTCGACGCAGCACTGCGTGCCCCG
AAGCTGGAACAACTGTTTCTGGAGCACAATGAGCTGGAAGATGATGCATTCTTGGGGCTTGCAAAACTGCGAAAACCACTGGCACTGCGACACCTTCGCC
TCAGCGATAATGACGTGTCGCCTATAACGCTGGGGGCGATCTGCAGCGCCAGTATGGATGGCGTACTGAATCTGGAGAGACTTGAACTTACCAACAACGT
GCAGATTGGCGATCCGGGTATACACGCACTAACACCGATGCTGGCTTCCCCAAGCGCTGGACCTGTAGCGGTACTTACGCATCTAGACGTTCGCGGCTGC
AATTTTGGCCTCGAAGGGGTGACCGCCTTGCTGCTAGCGCTGGGGCGCAACAAGACGGTCAAACACTTGAACCTCGCACAAAACTTTTTCGATGTTGGAT
TTGGCGACGTGCTCGCCGATTTTCTGGTCACCAACGACTCGGTCACAAATCTGCAAGCGAATGGCGTTGGATTGGGTTTGGCAGGTGTGTCTGCTCGGCT
GTTGACAGCATTAGAGAAAAATACCATACTCACATCACTATCGTTAGGAGCGAATCGACTTCGAAATGATGGTGCGTCTGCGCTGCTGCGAGCACTCGTA
AAGCGTGCTGAAACAAAGCCTTTCACGCTGGTTGACTTGAGTGGAAATCTTCTCACGTTGAGTGGGCTTGCGATGCTCACTGATATTTTGGAGATCCCTG
CTAGTGCGGATCATGCTCGCCCCGGTTACGCTAGCAGGAGTTGTATTGACGGGCAAGGACAGGAAGTTTTGGCAGATCGTAAACGACGGCGTATCGGTAG
CTTCGACTACCACAACTTGTCGAGTCCGCTTAACAAGCCAATCGAAGAGCTATGCTTGCTGAATAACGATTTCATCGGAATCGATGACGAGTACGCGGGT
GACAGCTCGACACTAATAGAATCCATCCGTCGCCGCGTAGGGCACCTGAAGAGTAACGAGTGGGCAATACAGCACCAAGTCTACGACGACGAAGTGTAAA
GCAAATACACATATTCCGGCACTCAATATGTAAAATCCCTGAGGAGCTTCTCACACCACTCAATGAAAGGGTGTGTTCCTCATTGCATCAATAACCCACC
TAACTACACAAAGTAGGATAAGAGAAATCCAAAGGTTCCTCCGAACCATCGACGTCGACCGTGCAGCACGAAGCATCAAAATTCACACCACGGCAATGCC
ACTGAGACTGTTCTTTGACGCTGCCACCTACCTCTCGAAGGATAACGACTGCATACTCGGATAGATTCCGAATTCGCGGTCAGTGCACTGAAGCTCGCGC
CATTCACGACCTTCCTTTCGCTTGATGAGTTGGCTCTGTTTCTCTCGTAGCTCCACGATCTGCGAATTGTAAGAGTCCAGTATGTCTTGCAATGGATGAG
GAGGTTCATCCTGCTCTCCATCCGAGCTAGTGTTATCAATATCGTCCGGCACCTCAACGTCTTCGTTTAAGTCATCATCATCATCATCGTCGTCGTCGTC
ATCCTCTCCTTCGTCGTAACCTTCATCTTCTCCGACTTCGTCTTCCTCTTCATCATTGGCTTGGGAATTCTCCTCGTCCAGGCGGCGCTTCTTTGCCAAA
TCAAATCTCTTTCCATATTGTTCATCCTTGCCCCGCTTGGATGGTTTCTTTGAGCTATCAGAAGTAAATTGTCGTACAAGCGGATACGGATTGTTATTGT
CTTTGGAATAGTGGCCACCCTTCGCATCAGATATATTGCTTGACCCCGACCCTGCAAAGGGAAAACGCACAAGATTCGTGAGATACTCCAAGAGAAAGCC
ACGTTTGAACTACTCATCAAACAGATTGATCCGACGGTCTACGTACATGCGTTATCGGACGAGCCGACAGAATGGCTATCCAGACCATCATCGTCGAGGT
CAGCGTCGGCATCGACTCCATCGCCCCATACATCTTCTTTTGCGTACCAACAACGTAAGGTAAGCTCATTAATGAAGTCGTGAGAGTAAGCAGTGAGAGT
AAGCAACGTACCTGGACTGGATTGCTTTCCCCCTGTGCTTGAGCTGTGCTCATCTGCGGCATCTTCATTGCCTGTCTGAGGCGTCTGAACTGGGGACCCG
AGAAGGGGGGATTGCTCATGATCGGAGTCATCTCCGTCCATGACAGCATCCTCGTTGCCTGTTTGGGGTGTCTGAGCTGGGGACCCAAGAGGCGAAGATT
GCCCATGGCTACCTCTATCATCTTCGATAGCACCATTTTCAGAGTTGGCATGCTTGTTGGCATTCTCTGAAAGCGCATTGATATGCGCATCATCAGCGGT
GGAGCTAGCACCAGCTTCGTAGTCAATCGCGTGATCGTGCTGCTTCGACTCTTGTTCATCGGTCACCCCCACGGGCGTGCCTAAATTCACTGTCGGGGTA
GATCCAGTGCTATCATCATTAGAAACCGCGCTTTCGTCCTGCTTCGTTTCTTGCTCGGACCTCAGCGCCATAGACGGTATAATATCTGGTGCCACATGTA
TCAAAACGAGATTCTCGAAGCCATCCAACGTGTCGAAACCTGCCCCACCATAAAAATGACACACAATTGATGATTAAGTTAAGACAGATTGGAAGTCGGC
AAGAAAGCTCAAACATCGGGGTTGCGTACGTTTTTCAAACTGGGTAAGGATATACTGGGCATCTGCGAACAAGTCTTGAAATGTGACGCCTGCACGGAAA
TCCCATGGTTAGCTCCGCACTAGTCACACAATTCAAGGATGCAAGTTTCTTTTCGAACCTGGTGTTAGGCTTGCAATTTTGGTGAAGAATGCAACCAAAT
TGTTGGTTCGGTACAATTCGATAGAATGTTGCATGCATCGAAGCACGTTATGTACCACCTCCTCAGTCCATTGGCACTGCTCTGCCACATCCCGGACAAA
TGCCGCATAGTCAGTTGCGGCCAAGGTACTACTCGGTGCTCTTTTAGAAGCTGATTGTGGCGATATACCAACTGCCCGCTCGCTTCGTAAGTTGTTTGGA
TGAGTAGCCCTGGAAGCAGGATTGGCTGCTGCGATGGAAGCACCACTTTGTGCAGGCATATCCACAGTCACCTTACGAGCTGCTATCGTTGTTGAACGAA
GCTTGGGCCGTGGGGCCCAGATACTTTTGCCTTTTCGCTTTTTATTGCGCACAGACAAAATACGGAGGCCTGTAAAACATCAATCAAAGGTCTTCGTCAG
CGAAATAAACTCTTGCGCTCACTTAAGAGACGATTCTATAACGTACACCGTGACTTGATCGCAAAATATCCAAGCGCGTAGGGATCGTTGTTGTCATTCC
AATCTAATCCCAACACAAACATGGCAAAAAAAGTTAAAAACAACCGGGCTTCTAAGCGCTTGAAAAAGTAGACAGCGAAGAGTCTGAGAGTTTTACCTGC
GTTAAAGATCTTGTACGCTTCTGACGTCGGATCAAACACAATGCCCGGCAAATCTAAGATTTTGCAACGAGCCCAAGTCAGGTTACATCATCAAAAGCAA
AACCCAGTAAAACGCATGTGCGTACTTGCTGCGCGAACCGATGTTGACTTTTTCAAAAATTTCTCCCGCATGTCAGCTAGTTTGTTCATGCATGACCCGT
CCGTTCGGTCTGACGCAAGGGAAAATATACAATGTCAGCGGCTATCAACATGATGAAACTGCACTGATACACTTACGCAGCGATTCGGCGACTTCGTTCA
CGAGGTCCGAGCTCCCATTCCTCTGGATCTCACTCGTGATCCGAACGAGGAAGTCAACAAGCGTCTCCATTTCTTCGGATGACCATAGTTTTGGAGCCTT
ACTGGGTGCTACAAGCTTTTCCTCTCGGCGAGCCGGGGGTACCTCGGAAAATATCTCTTTCAAAAGTTCAAGGCGTGCGATCTCCACTCTCGTTCGCTCT
TCACAGAAGCACGACCACATCCACAGATTTATCAGTCACGGTGGACGTCGAATCTGATAACCTGGAGTATCGCACTTACGACGTGAACGACGCTTCTCCC
TGATGTACAACTCACGCAGCGTGTAGAACTTGCTCTTTGACTCAGCAACCGATTTGCCTGTACATTTCCGCCAGTGCAACCAGTCACAATTTAAAGCCCG
TTTGCAGTCCACGACATGCATGAAACACTCACCCCACAATTGAACCCGCTTGAAATACACCTCCTGGGAACGAGAAAATAGTTCTCGATACTGCTTGGCC
TTCTGGAGGAAGCGACTAAGCTCGTCGGGCAGCCACACACCGCCAGACCTGTTTTCCAGTAGCTGACTAATCGACTCGTAGATGTGCTCGTACACATACA
CTCGTGCCCATTCGTCGCGATAACTGCTCCACACGTCACACAGAATCCCAACCAATGAGTCACCTCAACCAACAGCGCCCATTGCTCTCTCTTCGCTGCC
GTGTACCTTCTGTCCGGAAGTTCTTGGTGCTCAGCACGAGGCCGAATTGCAGCATCAGTGACCGCACCATCTCCTGGATCTCGACTGCTTTTTTACCTGC
ATTGCAAGACACACAAGTCAGCCTCAAGCCCCCATTATTGACGATACCAGTACACGATCTCCAATATGTTCGTTGATCGCTCGTTCTTGACGCACCGGGC
AGCTCTGCGCGCACGACCTGTGCGAACTCGGCGTCGGACGCGTATACGTAGTGCAGCAGGTGCTTGCGGAAGAGCGACAGCAGCGCCAGGACATCGGTGT
TGCCCCATCCGGGCACCCGCATCCTAGGCTTGAAAGTCCCGTTAGCTGAAGTTGATGGGAGCTGACCAGGATAGGTGCCGAATCTGATAGTTGTAATATG
AATGTTGCACGAGTGTAAATATGTTATGTACGCACACACCAAGGGGGACTTTTTAAACTGTTTAGTGGGAAATTGGTCCAGAGCGAGCCATGTCGGACGC
TGAGGACGAGCCGAGCAACCAGCGCGCGCTGCTGATCCCCGTCAAGAACTCGGAGCAAGCGGTGGAGGTGTATGTGGACGAGCTTCCGGATGACGTCAAT
GACATCATCGACATCCTGCGCGCAGAGGTGGCGCCGCTCGACGTTTGGCTGCAGTTCGCCGTACGTCCGCGTTTGATGAGACCAAACGCGGGATCAACTT
TTGACAAATTGTGATTTGTGATAGGTGGAGTACTATAACCAGGGCCATGTTGCCCAGTTCCAGGAGATCCTGGCCGTGGCGTCCGAGCCAGGCATCGAGG
AGATCTATAAAGACAATGCGTCGCGCTTGTGCCGCATCAAGTTTTTCGTCGCGTTGGCCAGCCACGCGGTCAACGCCATGTGGAACGAGGAGGACGAGAA
AAAACGCGAGGCTATCTCCCAGCGCGCCGTGGGCTACTTCCAGCGAGCCGACCGCCTGGACCACCAGCATCCCATGACGCTCGTGGGCAAGGCGCTAATG
TTTATGGCCAAGAACGAGGACGATCGCGCGGACCGCTTCGTCAAAAGTGTGCTCATCTCCAACAAGACCAACCTGCCGGCTATCTTGGGCAAGGCGCTGT
TGCTGTACCGCAAGAAGCAGTACAAGGATGCCAAGAAGCTCTATCTGGATGCAATCAAGCTGCACCCGCGCAGCCCCCAGGCAGCAAACATGCGCATGTG
CTTTGCGTACTGCTGCTACCATTTGGGAGCTGTGGAGAAGGCGCGCGCGGTGATGCGATTCACTGCATCGCTCGACGAGACCAACGTGGACGCAGTGATT
GCTAGCGCATTGTGGCAACTTGCGAGTCAGAGCCGCGAGGAGCGTGCCGTCAGCATCCGCGATGAAAGCTCGCGTTTCATGATGATGATCCACCACGCCC
ACGCTATCGACAAGACGAACCCGACGGTTCTAAACCACCTGGCTAACCATTATTTCTCGCAGTGGATCCCGCTTCCTTGCACGGTGAGCGTGGTGCGTGG
ATCGGCAGTTGTGGCCACATCCAAGGATATTTCCAATGAAGTCTCGCCAGGTCAGATTATTTGCATCGGTGACAGGTACGTTGCCTACATCAGCCGCAAC
GAAGATGCCGTGTCGCCGTCTGGGTTAAAGCTGGATGGCCCGTATCGCGAAGAGTCCGCGAGCGCTACGAATATTGCACGAAAGGATTACGATAAAATGT
TCACGCTTGCAGGAAATGCTTTCCACAGTACCAAAATTCCGGAGATCCGCTCTGAAAGCTGCTACCTCATGGGACGTGGCTGCCATGCCCAGGGCAAGTA
CAAGGACGCTTACAGCTACTACTTCAATGCTGGACGACTTTGGCCCAAGTTTGTGCTTCCGTGGTTTGGTCTGGCACAGATGTACTACGAGCGGAAGGAA
TTCACGAAGGCTGCGTCTTACTTGGAAAAGGCTAACAAAGCGTATCCTGAAAACGTGGAAATCCTGTCCCTTCTTGGCGATGTGTACGGCAAGCTCGGCA
AAAAGGACGAGGCCGTTGTTCTACTTCGTCGTGTCGTAGAACTCGAGCCGGGCAATGTGGAGGCACTGATCGGCACGGCTGAGCTTTTGCACGGTTCTCC
TGAACGAAAAGACCAGATTATCGCGATTTCATCGTACATTGCAGCGGAGAAGGTCATGAACAATGCCTCGGAGCGCGTACCTATGGAAGTTTATGTCAAC
CTGGGTGTACTTCAGCAGCGCGTTGGAAAAATGGCTGATGCCATTGACTGCTTCAAGAAGGCGCTCAAACAACTGGGAGATGGCAGTACTGCTGACCAAG
AGAGCAAATCGGAGGAGGCTGATGCCATTGCCGAGGAAGCCTCAAGTCCCAAGCCAACGGAGGCCAATGTCACAATCCTGTATAATATGGGACGCGTCTA
CGAGGAAATGGGCAACCGCGATCGTGCCAAGAAACTCTACGATGGGATCCTAGAGGTGTTCCCCCGCTACACCGACTGCTTGCTGCGCCTAGGCTGTATG
CTGCGTGATCGTGGCCAGGAGGTTGATGCGACGAAGATGTTTGATAAGGTACTGGAGGTGGACCCGGCGTGTGCCGAGGCCTGCCTGTTGCAGGGCAACA
TTCACTTGAAGAAGCGCGAGTGGGTGCTTGCTCAGAAGAAATTCGAAAAAGTGATGGGAATGCCCGGATTGAAGAATGACCCGTATGCGTTTTTGTCCAT
GGGCAACATCTTCATGAGCAATCTCGGTGAAAAGAATCGCTACACCAAGAATATGTCGCTGAGTGAAGTATACTACAAGAAAACGTTGGCGTCACACCCG
CACAACATCTACGCTGCCAACGGACTCGGTATTATGATTGCCGAGAAGGGCAACTTCGAGCTAGCAAAACAGATTTTCTCGCAAGTGCGCGAGGCCAGTC
CGGACATGCCAGATGCTTGGATTAATCTTGCGCACATTTTCGTCGCCGAAGAGCGTTACCAAGAGGCCATTCAGCTCTACACCGTGTGCCTTACCAAGTG
CTACAAAGGACAGGACCTTGAGGTACTGTTGTACCTTGCGAAGGCCTTTTACGAGTCAAAGGACTTCCCGAGCTGTATTTCGACGCTATCACGTGCACTG
CACATGTATCCGAATGATTTGCGTCTTTGGTACAACACGGGCCTTGCACAGGAAGACTACGCCGTGACGACACTTGGACAGGAGACGACTAGCACGCGGT
CAGGCAGTGGCAATGCAGTACCCCAACAGCGTACAATGGGTGATGTGCAGCGTGCCATCTTGGATTTGAAGCGAGCGCAGCGTATCTTCCGCTTCCTGCT
TCAACAAGCTGAGGTTACCGGCAATAGCGGCTCTAGTGAAAAAAAGAAACACCACAACAGTTTGCCCTTCGACAAGGAGAAGGTGTCGGAACACGAGAAT
TTCTGTGGCGACACCTTGACAAAGGCTAGCTATCACTTGGAATTCGAGCGACAAAAAGAGGAGAAGCGTCGGCTGGAGATCGAGGCTCAACGCAAGCTGC
TGCGCGAGTACGAGGAGCGTGTGGCACGTGAGCAGGAGGAAACTCGCGTAAAGGAAGACGACTTGCGCAAGCGCCACGAAGGCATCCGCCTCAAGCAGGA
CGAACGTTTGAAGAAATTGCACGAAGGCTGGAGTGTGCGTGAGCGCGAGGAGGAAGAGAAAGAGAAGAAGGTTGTCAAAAAGAAAGGAGGCAAGAAGCGC
AAAAAAACCGAGGACGAGGACGGCGGCTTCATTGACGACGCAGAGGACGAATTGGATGAGGACGGCGATAACAGCATGTCGATCGAGGACATGAAGAACC
GCAACGCGACCATGAAGAAGCTGGTGGAGAAGCGCAATAAGCGTGCGCGTGTGGGGTCTGGCTCGGAAGACGAGAAGGATGACCCCACCGGACTCTTTGG
CTCTGACTCAAGTGACGATGAACAGGAATCCAAACCAAGCGACACAATCAAGGATGATGACAAGCCTGCTGCAGAAGATGATGCGGCAGAGGATAGTCGT
GAAGCTGAGAAGAACGAACTGTTCGGCTCTTCCTCTGATGATGAGTA