Transcript Name :
Phyra_g8376
Orientation:
(-)
Number of Exons:
2
Description :
XP_009515479.1 hypothetical protein PHYSODRAFT_476945 [Phytophthora sojae
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-57
58-80
81-278
*** None ***
PositionContextScore
168PGKRKPR|DV0.597
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        952 bases(100 bases per row)
TGAAGACCCGCGCCCGCGCCGTGAGCTCCGACAATGCCAAGCCCACGATCGTGCTCAACCTGCCGGGCGTCCGCCTCGCCGTGCTCACGAGCGCCTACGA
CTCGCTCGTGCACCTCGACGTCACCCTCAGCTCGGCCGCGTCGCTCTTGCTCGCCACCTATGTCGCCTGCGTACTGGCCTGGAACGTCCTCGCGTTCGTG
CTCACGCTCCTGGTGCAGGGGGGGCGGCGTTCGGGCTCATCAGCTTTTACACCTTCATGGGCTGCGCCATGCTGTCCATGAATGCCTCACGCAACGCGGC
CTCCGTTCAAAACTACTACATCGCCAAGCCGGTGACTGCTACAGCCTCCACGCTCCCATTGCTCCGCGTTGACGGCGGGTTTATTGCGTCCAAGTCCACC
CATGTCGACAAGACAGACGATGCGGCCGCTTCCAAGAGAAAGGAGCGGCAGGCCCCGGCTGCCCGACGTCGTGTGCTGGCGCACCTGAACAAGAATCGCC
TCCTGGTCAATGTGGTGCCCGGTGACATGCGCCGCCGCGTCGACATGAACCTAGGCGAAGCGAACATTCGTGTGGGCAAGGCGTTCGTGCAGGCGGTCCC
CGGCAAGCGCAAACCCCGCGACGTCTACGTCATGCGCGTGGACTGCGGTGCCCAGTCGGCCGGCCAGGAGAAGCACATGAACCCCGTGGTCATGTGGGAC
GTGACTGCAACCTTTGACGAGTTCAAGCAACTCGAGCGCGAGCTGAAGAAGGAGGTCAAGGCGAAAAAGGCGTCGCGCGGAGTGAAAGTGCCGCACGTGT
CGAGCGGCGCTGTGCTTTTCGTGCAGCCTGAGCTCACGGACCATGTGCTCAACGCCCGCCGCGCCCGCCTGCAGACGTTCATCGACATCGTGCGCTCGGA
CCCAGTGCTTTCCACGATGGGGTGCTTGCGCAAGTTCTGCCAGGCCTACTAG