Transcript Name :
Phyra_g8373
Orientation:
(-)
Number of Exons:
5
Description :
ETI37614.1 hypothetical protein F443_16384 [Phytophthora parasitica P1569
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-340
*** None ***
PositionContextScore
32DEARKRR|AP0.501
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        1304 bases(100 bases per row)
TGGCGGAGGTGAAGACAGCGACGGAGGCCAACGGCGCGGCGGCTAGCAAAAGCAACGGCCGCAGTCGCGAGGAGGACGAGGCGCGGAAAAGGCGGGCGCC
CCCCGGTGCCAATGCCACACCCGAGGAACGTGCGCGTTATGAGCTGGAGCGCAAGAAGGTGGCCAAGTACAAGGAGGACAAACTCAAAGCGCGGCGCGAC
CACACACGCATGATCCTGGAGAGCCACGCGCAAGCCAAGCGACGCGCGTTGCTGGGCAAGCAGTCGGAGTTCTTGGCCAGCCTCGAGTTCCGCAACTCGC
TGCCGGACATCCCGTTTGACACCAAGTTTGTCAAATACCCGCACGAGCCGGAACGGTGCGACAGTGGCGAGCTGCAGAATGGGAGAAAGGTGGAGAAGCT
GATGATGTGGTGGTGGTTTATGTGCACAGACTCATCAAGTACAAGCCCAACACACTCGAGATGGACTACACGTACGAGATCCACGAGGAGCCGAACCTCG
GACTGACCATCGACCTCATCGATCCGGCCAAATATGAAGGTAGAACTCTTATCTGGGGGATTAGGATGTAGAATTTTGTGCTAAAATGTCGCGGATGGAT
TTTTGCAGCCCCGACGGACCCCGAGCCGCTGGAGGTTGGCGATGAGCAGGCGCTGATGATGAAGGAGGACCATATGGGCACCAAGGGCCGATCTAAGGTG
CGCCCCACAGTCTCCTGGCTGCGACGCACGGAGTACATGGGCAACGATCTGTACGATTCCGTGCACAAGTTCAAGAGCGAGGCAGAAATTCAGAGTGCAC
TGCGTGAGGGCACGGAGAATGCGCTGGCCGAGGTTGTGTCCGTGACGTTAGAGGACCGTGCCGAAGCGTCCTTCCGCGACATTAACGATCCAAAGTTGTT
GGTGCACCCGCACAGCAAAAGGAAAAAAATCGCCAAGGTGTGGGATGTCTTCCCCGATCAGCTCTTGTCTGCCAACAAGTATGCAATTCTGGTACGTCTG
CTCGCAGCGGAATTTCGGTATGCGTTATGACACAAGCTGACAGGATACTAATTTCTGTGGACTTGCAGTCGTACGATATTCTTCCTTCCGAAGATGTCAA
GAGCAAGGGAATCACAAGCCGCGAGGATCGTGCACTGCTGTGCGGCGTAAACAAGAAGACCCAAGCTGGCAAGGAACTTATTCAGGGCTCTATCCTGCTG
CCCAACGGATCGGCAGAAGAAGAGGTACACCCCTGTTATGCATGCACTAAAGCACCGCGGCACAAGCTAATGGGTGAATTGTTTCTTCTACCACAGGACA
GTAG