Transcript Name :
Phyra_g6573
Orientation:
(+)
Number of Exons:
3
Description :
unknown protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Integrase, catalytic core9.163PS50994
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-148
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
DNA integrationGO:0015074IEA
*** None ***
*** None ***
Sequence
        726 bases(100 bases per row)
ATGCAGACGCCAACGTTGGGGCAAGCGCTACTTCGTCACGTTCATCGACGACAAGTCGCCTTCTGCGTGGTGTACTTGCTGAGGAACAAGTCCGAGGTGG
CTGCCAAGTTCGCGGAGTTTGTGGCGTTTGCTGAAAACTCAGACCGGCAAGCGCGTGCAGACACTCCGGAGCGACAACGGTGGCGAGTACACTTCCGGCG
CGATGGCCAAGGTTCTGTGCGGACCATGGTATCGTGCAGAAGTTCACTCCGCCGTACACGCCTCAGCTGAATGGAGTGGCCGAGCGGATGAACCGGACGT
TGGTGGAGTGTGCGCGCTGCATGCTGGAACATGCCGGATTGCCCAAGACGTATTGGGGTGAAGCGGTGATGACGGCTACGTTCCTCCGTAATCGGTGTCC
GACACGCGCCATCAGCCACGACAAGTCTCCGCACCAAGTCTGGACGGGCAAGAAGCCGCTGCTGGCGAACCTGAAAGTGTTCGGTTTGTTGTCAAGAAGG
CGCTCGGGCAGCTGCCGTATACCGGTAGGATACCGGTATGACCTTCACTCAGTGGGACCGCAATCATTCCTGTGTTGACGGGACGCTGATGATGGGACGC
GGGACACTGATGATGGGACGCTGTTTACGCTACGGGGATTACGGGACACGTGGGTACAAGATTTGGGTACAAGATGGGCATCCACGCGGCAGTCGCTGAT
TGGCTGAAGCAACTCAGTATCCGGTA