Transcript Name :
Phyra_g7134
Orientation:
(+)
Number of Exons:
5
Description :
hypothetical protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-6
7-29
30-313
314-336
337-342
343-365
366-396
397-419
420-799
800-822
823-831
832-854
855-942
943-965
966-1715
1716-1738
1739-1757
1758-1780
1781-1789
1790-1812
1813-1854
1855-1877
1878-1964
1965-1987
1988-1998
1999-2021
2022-2030
2031-2053
2054-2057
2058-2080
2081-2244
*** None ***
PositionContextScore
87EFNSSKR|SF0.536
2206SLSRTRR|AF0.771
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        7915 bases(100 bases per row)
ATGGGCCGGAGGACCTGCGCGCTGCTGCTGCTGGCGCTCACGGCGCTGCTACTGCCCGCGGGCGGCGAGGCATTCCTGCCCATCACCCGCCACAACCTCA
CGGCTCTCCAGAAGCGGTGGATCGACCCGGACACGGACCCCAAGTTCTACAACCTCTCGGTGCCCGCGGGGCCGCAGAACTTCCCAGACTACGGCGGCAA
CGCCAGCGAGATGAACGAGTACACGCTCATCTTCTCGGACGAGTTCAACAGCTCCAAGCGCTCGTTCGAGGCCGGCTTCGACTCCAAGTGGACGGCCCTC
GACATCCGAGATACGACCAACATGGGGCAGCACTACTTCCTTCCCCAGGCCGTGCAGATCGACAAGGGAAACCTCGTCATCACCACCTCCAAGCCCAAGA
AGCGCTACCGCGGCACCAAGTACGTCAGCGGCAGCGTGCAGACGTGGAACAAGTTCTGTTATACCGGCGGCTACATTGAGGTCAAGGCTATCTTGCCTGG
CAAGTGGGGCATCCCCGGCACGTGGCCGGCTATCTGGATCATGGGCAACATTGGTCGTGCTCCGTTCCTGGGCTCCCAGGACGGCACGTGGCCGTGGAGC
TTCGATGTCTGCGCCCCCTTTGTGGAGAAGACCGAGAAGGTCAAGCAGAAGATTAGTGCCTGTGGCAACCTGACCAACAAGCACGACAAGAGTTCGTACC
CGGAGATGTACGGCTTGAACCCGTTCCAGGGTCGTGGTGCCACGGAGATTGATGTGATTGAAGCGCAGATTCGCGCCCGCGATGAGCCAGCGTTTATCTC
GACGTCGCTGCAGATCCGTCCTAGTCTGTCTGAGGACATGCGTCCGGGTTCGGAAACGCTTCCTGCTCCTGGACAATGGTATCAGGGCCTCAAGTTCGGC
GAATTCACGCGTATTAACAGCGACTACTATGGTGAGGTTGGTCTCGACTCAATCTCAGCTTTGACGCAGCTTGAAACCAACGCGTTCAGAGATTTCCACT
TGTACCGCCTGGATTGGTCCCCTGGTCCAGAGGGTTACATCCGTTGGTGGCTCGACAGTGCCTTCTTGTTTGAAATTCCCGGCTCAGCGCTGAGCAAGTG
GGTGGGTGATGTCCCTCCTCGCCAGCTTCCTGTGGAGCCCAGCTACATTATTCTGAGTACTGCTGTCTCTGAAAGTTCTCCCCGCCGTGCGATGGTCAGA
TTTGTGACTCGATATGGCCCTCGAACTTCACGATTGACTATGTGCGCGTGTACCAGGGCAAACCGAACCGATACACGTCGGTGGGATGCAACCCAGAGGC
GTATCCTACGAATGAATGGATCTACTCGCATCCGGTAGACTATGGTCTTCCGTGGTACGGCTCGCTGCGCGTGGACACCATCCTTCTGCAGCTTTTCGCA
GTGATTAATGCTCTTGTGGGCTTTTCATGGCTTTCCGAGGCACGTCTCACCCGAAGACGATGTCAGCCTACGCTAGCTCGTTGTGGCTTACTGCGTTGTT
TTATGGAGCGATAAGTGCAAGCGCCCCAGAAGAATTTGCCTGGATCCAGACTGCTGTTGCATGCCTGTGTGGTTTCGTGGTCGGTGGTATTTGCTGTCTC
GTGTACCCGATTTCGCTAGGTGCGATGCTTGGTTTGTATGGTGGCGTAATGATAAGCCAGTTCGTGCCTTTGCTTTCTACGCGGGTGATCACTGCTGTGT
TTGTGGGTGTGGGCATCGCGCTGGGGTGTGCGCCGCAGATCGACACCAAGCACATTGTGATCCTGTCAACGTCTTGGCTGGGCAGTCTGGCGTTTTTGCT
ATCGATTTCGCTTTGGGTGAGCGAGGGTGACATTGCCGACAACGCGTGGAACCTCGCTGGCTTTATCCTCAACGGCGACAGTCACGACCATGTTGGTTTT
TGCTCGGAGCACTGCTTAGCGATGTATGCGCTTCTTCTCGTGCTCAGTGCGGTCAGCACAATCTATGGGTATTACTACTTGCGTGGTGTGACATTGCGCC
ATAACGCGATTAGTGCGCGCAAAGCTAAATTCCCGCAGGTTTCTGCGAGTTCGGACGCTCGATCGTGGAGACCTGATGAGGAAGTGTCGGGAGCTGAGAA
GAACATGACCAACTTCTTTTCACCGAACAAGCTGCCGCACAACATGCAGCAGTTCAGCACAATTTTCCGCATCGCTGTGAATGTGCAGCGATCTTTTGGA
TTCCAACTTGACAACTTCCGCAACCAGACAGAGCACATCGTAGTGTTGCTCACGAACAACACTCGTAAGAATGGGAACCCGTATCGAAAGCTGCACGATT
TGGTGTTTTCTAACTATAACAAGTGGTGCTCGAAGTTGAGGATTCAACCGCTGCAATGGAGTGAGCAGCGGGCGCCACAGGGAGGCCTTACGAGCGTGGA
CGAGATCTCGGTGGACTTGTGCCTGTTTTTCTTCATCTGGGGTGAGACTAGCAACCTGCGCCACTCTCCCGAGTTCTTGTGCTACCTTTTCCATAAGATG
AAGGAGGAGTTTCCGTCGGTTCGTCACTCCGAACGCGAGGCTGGATACTTCCTGGATACGGTGGTAACACCTGTCTACGGCCTGTTGAAGGCTGAGATGA
TGTCGAAGCACGACCACGAGGACCGCCACAATTACGATGACTTCAATGAGTTCTTCTGGACGAAGGCATGCCTGAAATACGACTACAAGCACGAGGAAGT
TCTCGACATGACGTCGCCGAGCCCTGCCATGATTTACCAGCAGAAGAAAATGCAACGTGAGGGTCTAGGAGGCCTCAGTACCCGAGGTGGGCTGAACGGT
GGTTCCAAGAGCGGCAATTTCTTCCAGAAACGCAAGAGTATTGCTGAGGGATTCACTGAATCGGCGAAGACGTTCGTGGAGAAACGAACATGGTTACTAC
CGCTGCGCGCCTTCAACCGTATCTTCAATTTCCACGTGATTTCATTTCACTTGTTGGCAGTTCTCGCTTTTGCTAACGAGCAAGAGATGAACTTTGACGA
CTTGTGCAAAATCACGTCAAGCACTCTGATCACACCCTTCTTGCTGGACATTCTGCGTGATGGTCTCGACATCTTCGCAGTGTACCATGTGCACCAGAGA
GCGTTTTCGACGGTGCGTAATGTTTTGCGGGTGCTTTTGCATCTGGCGCTTGTGGTGACGTCGTCAATGCTGTACTGGTACGCTTGGGCGTATGGTGGTC
TGTGGTGGCAGACGTACTACGTCGTCACGGTGATTTTCCACGTGCCTGGGCTGATCAACAGCGTCATGCAAGTCATGCCCGGCCTCACAAACTGGACGCG
ACGTACTACGTTTGTTCCCATTGCCTTTATCCGTGATATTGTGAGCCCGATGAACCGCCTGTACGTGGGCGACAACGTCTTGGACCCGGAGTCTAAGAGC
GTGGGCTACCAGTTTTTCTGGGCTTCGCAGCTTTTATGGAAGCTGTACTTCAGCTACAAGTTTGAGATTTCCCCGCTTGTGGTGCCGAGCTTCTTGCTGT
ATGCCGACCATGTGGAGAATAACGTGAGTATGATTACAACGATGTTTCTCATCTTCCTGAACTGGATGCCATTCTTCTTGGTCTTCTGCGTGGATATCAC
GATTTGGAACTCGATCTGGATGGCTTTCACGGGTACCTTTGTGGGCTTTTCAGCGCACATTGGCGAAATTCGCAACTTTAGCCGTGTGCGTTCTGCGTTT
AGCCGTGCTGTGGATGCGTTCAATGCAAAGGTGATCGCTCGAAACTCGAAGACTGGACTTCAGATTGCTGAGAGCACGGGAATGTCGTACGGAACAACCG
CTGTTGGCCACGAGGTGCTAGATCGCGTTGCAGGTGGCGCGGACCCGACGTCTCGAATTTTGTCCCAGCGACGTACTTCGGTGCATGATGATGAGACCCT
CTGCTCTCTTTCTCGCGTCGCAAGCAGACACCAATGGAGCGCCAAGCTGCTCGTCGGCGCAAGTGGTTCTCGTTCTCTATCGCATGGGATACTATTATCG
ACAGCATGCGCGCGGACGATTTGATCTCGAACAGGGAGAAGGCTCTGCTTCACTTTCACCGCCTCGATGGTTACCAACGTGAGATTTACCTGCCACAGTT
CCAACTGGCTGGTTGCTTCGAAAACTTCACTTCCAGCATCCTTGACATTTACTCATCTAATGACGGCAAGGTATCGGAACGTGTGTTGCAAGACAAGCTT
CTGGAGATTCTCAGTGAAAGTCCGATGGTGGAGGAATCCGTCGAAGAGATTTGGGAGCTTGCGAACTGGATGCTTGTCAACGTGCTCGGCCCGTGCCACA
GCAACGATGTGAAGTACATCACAAGTGTTCTCAACTCATGGGCAGCACGCGGTGTATTCCGCGCACTTAACCTTCAGAAGGTGGCTCCTTGCGGTCGTGC
TTTGGCTAGCTTGGTGTTGTTATTGAAGTCCAACGCCCGTGCCTGGAAGAACGGCGCCAAGGTTATCCCTGTGCGCAAGGATCCCTCTGATTATGCGTCG
TACGAATTCCCGCAGCAGTCGAGCTCGTACCGCCCTGCTCCGTCGGGCCTTACAAAATCTGCTAGTACGACGGGGTTGTCGTCCTTGGGCCTTGAGCCTC
CTCGTCGCAGTCGTGGTTCTGGAGTTGCTCGTATTGCGCGTATGCAGCAGCAGACGCACAAACCCGCGGTCAACAATGGCAAGGCCACGCACTCAATTCC
GAGCGCTCACATCATGCAGATCCGCGAGCGTGTGCGCACGTTCCTGAACTTAGTGAAGGAAATGCTGGCTCATGTTCACGAGCAAGATCCGGTGTACACG
GAGAGCAAGGGTATTTCGGACCGATTGACATGGATTCTTACGCAAGAGCGCGGTTTCATGTGGGACGATAACTACACGGGTGAACAGATCACGCTGACGT
CGTTTGAAAGCCACACGGACGTGGTGCTGTCACACCTGCATGGACTTCTTACCTTGCAGAAAATTGATGCTGAGCCACAGTCTTACGATGCGCGCCGCCG
TCTGCTGTTCTTCGTGAACTCGATGTTTATGGATATGCCGTTGGCGCCGTTGCTCGAGGAAATGAAGTCGTGGAGCGTCATGACCCCGTTCTACGCCGAG
GACGTGCTGTACTCAAGAAAGGATCTTGAAAGTAAGCAGGATGGTTTGGATGTGCATACTCTGCTGTTCTTGCAAACGCTGTACAAGCGAGACTGGGAGA
ACTTCCTGGAACGAGTGAAGCCGAAGAAGAACATCTGGAAGGATCCAGAGACTGCTATTGAGCTGCGTATGTGGGCTTCCTTGCGTGGCCAGACGCTGTC
GCGTACGGTTCAGGGTATGATGTACGGTGAAGCAGCCATTCGACTGCTTGCGGAGATTGAGCAGGTGCCGCAGCAAAAATTGGAGGAACTGATCAACACG
AAGTTTACGTACGTCGTGGCTTGCCAGATTTATGGCCGCCAGAAGAAGAACAATGACCCGAAGGCGAGTGACATCGAGTTTTTGCTGCACCGCTTTCCGA
ACCTCCGTGTTGCTTACATCGATGAGGTGCGCGTGAACTACCAGAAAGAGCAGTCTTACTTCTCGGTACTCATCAAGGGTGGCGAGGAGCTTGGCTCGGT
GCATGAGATCTACCGTGTGCGGCTGCCAGGCAACCCCATCTTGGGTGAAGGTAAGCCTGAGAACCAGAACTCGGCCATTGTGTTTACTCGTGGCGAAAAC
TTGCAGACAATTGATATGAACCAAGACGGATACCTCGAGGAAGGGCTCAAGATGAGAAACCTCCTCGAAGAGTTTGACAAGGGCACAGCTGACCGGCCGT
TCACAATCGTGGGCATCCCAGAACACATTTTCACGGGTAGCGTGAGTTCGCTGGCTAACTACATGGCACTGCAGGAGACGTCCTTCGTGACACTGAGCCA
GCGTACACTGGCGCGGCCACTGCGCATGCGTCTGCATTACGGTCACCCTGATGTGTTTAACAAGCTCTTCTTCATCACGCGCGGCGGCATTAGCAAGGCC
AGCAAGGGCATCAACCTCAGTGAAGATATCTTTGCGGGCTACAACAATTGTATGCGAGGGGGTTCTGTGACCTTCCCGGAGTACACGAAGGTCGGTAAGG
GGCGTGATGTCGGTATGCAGCAGATCTACAAATTTGAGGCCAAGCTGGCTCAAGGTGCAGCGGAGCAGTCGCTTTCGCGTGATGTGTATCGCATTAGTCA
GCGACTGGACTTCTTCAAGCTGCTGTCGTTCTACTACAACCACGTGGGCTTCTACCTGTCGACGTCAATCATCATCTGGACCGTTTACATCCTGTTGTAT
TGCAACCTGCTACGCGCTTTGCTTTCACTTGAGGGTGTTGGCGGTCGCGAGCCTGTACTGCTGAGCAATTTGCAGCTGATGCTTGGCTCTGTGGCGTTCT
TCACGACTGCACCGCTGCTGGCAACGATTTCTGTCGAGCGCGGCTTTAAGGCTGCACTGAACGAGATTGTGGTCCTCTTCGTCACGGGTGGCCCGCTGTA
CTTCCTGTTCCACATCGGCACGAAGTGGTTCTACTTCGGACAGACCATTCTTGCCGGTGGTGCTAAGTACCGTGCGACGGGTCGTGGTTTCGTGACGAAG
CACTCGTCTTTCGACGAGCTCTACCGTTTCTGCCAGCAGCCACCTGTATGCTGCAGTGGAGATTGCTATTGGACTCACCCTTTACTACAAGTTCACAGTT
GGCTTCCAGTACTTATCGACGACGTGGTCGCTGTGGCTTGTGTTTGTATCTTGGTACTGGTCTCCGTTCTGGTTCAATCCGTTGGCGTTCGAGTGGTCTG
ACGTGATGGAAGATTTCCGTTTGTGGTTCAAGTGGATGCGCGGTGACGGTGGCAATCCAGACCAGTCATGGGAGGCGTGGTTCAAGGAAGAGAACGCGTA
CTTCTCAACGCTCCGTCCGTGGTCCAAGGCGTGCATTACGGTCAAGGGTGGATTGTTCGCATTGATCGCGCTCTCTATTTCATCGACGAGTGATGAATAT
CACTCGATCCTGACTGAGTCGACGTGGCTTCCGTTGGTAATCTGCTGCTCCATGGCTGCAGTGTACCTTAGTGCCGAGGCAGTCTTCTTTACCTCATCGC
GTTCCAACGGTGAGAATGGACTTGTTCGATTCCTGAAGCTCATATTGGTGCTTGTGCTGGGCGCTGGCCTCATCCTCGCCTTCATTTATGTGGATGGTAT
GTGGCAGTGTCTGCTGAGCATGGGATACCTCGCTGCGGCTGTAGGCTGCTGGGCGCTTGTGCTCCTCGGTAGCAACTCGCGTTTGGTTGGCACGCTTTAC
TTTGTGCACGATGCTGTGCTCGGTTTGGTGTCGTTGAGTCTCATCCTGCTGCTCGCGGCGCTTTATGTCCCCGGAAAGATCCAAACATGGCTGCTGTACA
ACAATGCGCTAAGCCGCGGCGTGGTCATCGAGGACATCCTCCGAGCCAACTCAAGCAATGACGACCGCGATGACGACCTGTCGGTGCAACAGATGCGCTC
GATCATCATGGAGCAGCAACGATTCATCAACGTACTGACTGCCAGCGGCAGTGATGCCGACACGTGCTGCTGGCTCTGGCAAGAAGGAAGACCTCATGCA
CGCTATGAGCGACAACACGCTTAACGCGGTGTTGCGGAACATGTCGGAGACGGAACTGAGCGCACTGCAGGACTCATCTAGCCGCCTGCAGGCCATTATG
TCGGAGGAAGAACGCAAGGTGGCGCATCGCAAGAAGCAGCAGGAAGAGCAGAGACTCGTCGAGGCGGGCATGAACCCATCACTGTCGCGCACGCGCCGAG
CCTTCTCCACGAGCGATTTTTCGGCCATTCTGCCGAACGCGAACCCCTTCAACCCCCCGAACCAGAACGGCCCTAGCAATGGTGCTGCCACCAATAACGG
CCACACTGCCGTGTA