Transcript Name :
Phyra_g7114
Orientation:
(-)
Number of Exons:
7
Description :
RNA polymerase II-associated factor 1
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-366
*** None ***
PositionContextScore
8AESRGGR|GA0.571
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        1533 bases(100 bases per row)
TGGCGGAGGTGAAGACAGCGACGGAGGCCAACGGCGCGGCGGCTAGCAAAAGCAACGGCCGCAGTCGCGAGGAGGACGAGGCGCGGAAAAGGCGGGCGCC
CCCGGTGCCAATGCCACACCCGAGGAACGTGCGCGTTATGAGCTGGAGCGCAAGAAGGTGGCCAAGTACAAGGAGGACAAACTCAAAGCGCGGCGCGACC
ACACACGCATGATCCTGGAGAGCCACGCGCAAGCCAAGCGACGCGCGTTGCTGGGCAAGCAGTCGGAGTTCTTGGCCAGCCTCGAGTTCCGCAACTCGCT
GCCGGACATCCCGTTTGACACCAAGTTTGTCAAATACCCGCACGAGCCGGAACGGTGCGACAGTGGCGAGCTGCAGAATGGGAGAAAGGTGGAGAAGCTG
ATGATGTGGTGGTGGTTTATGTGCACAGACTCATCAAGTACAAGCCCAACACACTCGAGATGGACTACACGTACGAGATCCACGAGGAGCCGAACCTCGG
ACTGACCATCGACCTCATCGATCCGGCCAAATATGAAGGTAGAACTCTTATCTGGGGGATTAGGATGTAGAATTTTGTGCTAAAATGTCGCGGATGGATT
TTTGCAGCCCCGACGGACCCCGAGCCGCTGGAGGTTGGCGATGAGCAGGCGCTGATGATGAAGGAGGACCATATGGGCACCAAGGGCCGATCTAAGGTGC
GCCCCACAGTCTCCTGGCTGCGACGCACGGAGTACATGGGCAACGATCTGTACGATTCCGTGCACAAGTTCAAGAGCGAGGCAGAAATTCAGAGTGCACT
GCGTGAGGGCACGGAGAATGCGCTGGCCGAGGTTGTGTCCGTGACGTTAGAGGACCGTGCCGAAGCGTCCTTCCGCGACATTAACGATCCAAAGTTGTTG
GTGCACCCGCACAGCAAAAGGAAAAAAATCGCCAAGGTGTGGGATGTCTTCCCCGATCAGCTCTTGTCTGCCAACAAGTATGCAATTCTGGTACGTCTGC
TCGCAGCGGAATTTCGGTATGCGTTATGACACAAGCTGACAGGATACTAATTTCTGTGGACTTGCAGTCGTACGATATTCTTCCTTCCGAAGATGTCAAG
AGCAAGGGAATCACAAGCCGCGAGGATCGTGCACTGCTGTGCGGCGTAAACAAGAAGACCCAAGCTGGCAAGGAACTTATTCAGGGCTCTATCCTGCTGC
CCAACGGATCGGCAGAAGAAGAGGTACACCCCTGTTATGCATGCACTAAAGCACCGCGGCACAAGCTAATGGGTGAATTGTTTCTTCTACCACAGGACAG
TAGCGATCGCGAGAAATTCTCGTACCTCCGCGAGTATCTTATGGCGGTGGAGTCGCTTGATAGCGTACGTTGGCGATTTTGATTCTGTTTCAGCTGAATT
GTTGTGCTCACTTTGATTTATTTCTGTTTATTGGTGTTCGCTGCCTCAGAGGGAGTCACAACATGTTATGTTCATGCTAGACCCGGAGTCCGACCATTTC
ACATACAGTGACGTTCTGAACCGCATCAGCTGA